Incidental Mutation 'R3940:Rnf123'
ID 307415
Institutional Source Beutler Lab
Gene Symbol Rnf123
Ensembl Gene ENSMUSG00000041528
Gene Name ring finger protein 123
Synonyms KPC1
MMRRC Submission 040922-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.171) question?
Stock # R3940 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 107928869-107957183 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 107941234 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000162355] [ENSMUST00000178267] [ENSMUST00000162753]
AlphaFold Q5XPI3
Predicted Effect probably benign
Transcript: ENSMUST00000047746
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159136
Predicted Effect probably benign
Transcript: ENSMUST00000159306
SMART Domains Protein: ENSMUSP00000125695
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
coiled coil region 172 192 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160249
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160649
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161673
Predicted Effect probably benign
Transcript: ENSMUST00000162355
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178267
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162753
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 95% (35/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 69,438,135 (GRCm39) A53T probably benign Het
Acsm3 A G 7: 119,373,109 (GRCm39) E204G probably benign Het
Acta2 A T 19: 34,220,880 (GRCm39) I276N possibly damaging Het
Ankrd16 T C 2: 11,789,192 (GRCm39) C260R probably benign Het
Ankrd42 T C 7: 92,240,996 (GRCm39) probably null Het
Atp13a2 T C 4: 140,733,733 (GRCm39) S1041P probably damaging Het
Brinp3 C A 1: 146,627,599 (GRCm39) D277E probably damaging Het
Calm5 A T 13: 3,904,485 (GRCm39) I37F possibly damaging Het
Casq1 A G 1: 172,047,103 (GRCm39) V52A possibly damaging Het
Col22a1 A T 15: 71,853,782 (GRCm39) L260* probably null Het
Cttnbp2 C A 6: 18,420,974 (GRCm39) V846L probably benign Het
Dnah12 A G 14: 26,444,754 (GRCm39) T627A probably benign Het
Eogt T C 6: 97,090,875 (GRCm39) I421M probably damaging Het
Fam135a T A 1: 24,096,556 (GRCm39) H63L probably damaging Het
Fmo3 T A 1: 162,791,555 (GRCm39) T241S probably benign Het
Frem3 T C 8: 81,341,649 (GRCm39) I1314T possibly damaging Het
Gm14393 T C 2: 174,903,420 (GRCm39) probably null Het
Kcna5 C T 6: 126,510,614 (GRCm39) V505I probably damaging Het
Kit A G 5: 75,769,978 (GRCm39) D130G probably benign Het
Neto2 G A 8: 86,400,747 (GRCm39) T16I probably damaging Het
Or7a41 T A 10: 78,871,038 (GRCm39) I136N probably damaging Het
Or8k40 T A 2: 86,584,275 (GRCm39) D269V possibly damaging Het
Pcdhb7 T C 18: 37,477,021 (GRCm39) L719P probably damaging Het
Pcdhga9 G A 18: 37,871,995 (GRCm39) R608H probably benign Het
Pik3ip1 A G 11: 3,281,987 (GRCm39) N48S probably damaging Het
Pkn2 G A 3: 142,499,672 (GRCm39) S951L probably damaging Het
Prrc2a T C 17: 35,376,474 (GRCm39) H772R possibly damaging Het
Ric1 T C 19: 29,548,162 (GRCm39) Y277H probably damaging Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Robo1 T C 16: 72,806,631 (GRCm39) S1166P probably benign Het
S100a10 A G 3: 93,468,383 (GRCm39) E38G probably benign Het
Slc34a1 A T 13: 55,560,983 (GRCm39) I483F probably damaging Het
Stim1 A G 7: 102,084,848 (GRCm39) N600S probably benign Het
Ube3c T A 5: 29,824,358 (GRCm39) N517K probably benign Het
Other mutations in Rnf123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Rnf123 APN 9 107,944,594 (GRCm39) critical splice donor site probably null
IGL01358:Rnf123 APN 9 107,946,381 (GRCm39) missense probably damaging 1.00
IGL01464:Rnf123 APN 9 107,929,501 (GRCm39) missense probably damaging 1.00
IGL01637:Rnf123 APN 9 107,935,437 (GRCm39) missense probably damaging 1.00
IGL01669:Rnf123 APN 9 107,935,555 (GRCm39) missense probably damaging 0.98
IGL01905:Rnf123 APN 9 107,948,569 (GRCm39) splice site probably benign
IGL02070:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02072:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02073:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02074:Rnf123 APN 9 107,944,088 (GRCm39) missense probably damaging 1.00
IGL02079:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02080:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02231:Rnf123 APN 9 107,943,598 (GRCm39) missense probably benign 0.17
IGL02281:Rnf123 APN 9 107,948,651 (GRCm39) missense probably benign 0.01
IGL02336:Rnf123 APN 9 107,939,041 (GRCm39) missense probably damaging 1.00
IGL02543:Rnf123 APN 9 107,943,547 (GRCm39) missense probably damaging 1.00
IGL02565:Rnf123 APN 9 107,929,411 (GRCm39) critical splice donor site probably null
IGL02571:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02572:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02574:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02586:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02589:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02600:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02601:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02602:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02603:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02609:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02628:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02629:Rnf123 APN 9 107,947,988 (GRCm39) splice site probably benign
IGL02629:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02630:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02631:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02632:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02650:Rnf123 APN 9 107,946,947 (GRCm39) missense probably benign 0.29
IGL02690:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02691:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02692:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02693:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02713:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02736:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02929:Rnf123 APN 9 107,946,275 (GRCm39) missense probably benign
R1175:Rnf123 UTSW 9 107,954,572 (GRCm39) missense probably benign
R1465:Rnf123 UTSW 9 107,948,665 (GRCm39) splice site probably benign
R1502:Rnf123 UTSW 9 107,945,709 (GRCm39) splice site probably null
R1682:Rnf123 UTSW 9 107,954,597 (GRCm39) missense probably benign 0.16
R1817:Rnf123 UTSW 9 107,940,125 (GRCm39) missense probably benign 0.41
R1855:Rnf123 UTSW 9 107,938,990 (GRCm39) missense probably damaging 1.00
R2394:Rnf123 UTSW 9 107,940,735 (GRCm39) missense probably benign 0.00
R2483:Rnf123 UTSW 9 107,940,720 (GRCm39) missense probably benign 0.16
R3896:Rnf123 UTSW 9 107,946,302 (GRCm39) splice site probably benign
R4206:Rnf123 UTSW 9 107,941,162 (GRCm39) missense probably benign 0.01
R4641:Rnf123 UTSW 9 107,935,786 (GRCm39) missense probably damaging 1.00
R4714:Rnf123 UTSW 9 107,929,638 (GRCm39) splice site probably null
R4767:Rnf123 UTSW 9 107,929,288 (GRCm39) missense probably damaging 1.00
R4849:Rnf123 UTSW 9 107,933,290 (GRCm39) missense probably damaging 1.00
R4899:Rnf123 UTSW 9 107,940,879 (GRCm39) missense probably damaging 1.00
R5274:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5275:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5276:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5294:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5295:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5394:Rnf123 UTSW 9 107,947,930 (GRCm39) missense probably damaging 1.00
R5717:Rnf123 UTSW 9 107,944,623 (GRCm39) missense probably damaging 1.00
R6186:Rnf123 UTSW 9 107,947,157 (GRCm39) missense possibly damaging 0.55
R6449:Rnf123 UTSW 9 107,933,252 (GRCm39) missense probably benign 0.17
R6502:Rnf123 UTSW 9 107,945,531 (GRCm39) missense possibly damaging 0.46
R6944:Rnf123 UTSW 9 107,940,822 (GRCm39) missense probably benign 0.02
R7003:Rnf123 UTSW 9 107,940,882 (GRCm39) critical splice acceptor site probably null
R7088:Rnf123 UTSW 9 107,935,735 (GRCm39) missense probably null 1.00
R7092:Rnf123 UTSW 9 107,945,799 (GRCm39) missense probably benign 0.07
R7100:Rnf123 UTSW 9 107,933,838 (GRCm39) missense probably damaging 1.00
R7257:Rnf123 UTSW 9 107,946,228 (GRCm39) missense probably damaging 1.00
R7453:Rnf123 UTSW 9 107,947,607 (GRCm39) splice site probably null
R7468:Rnf123 UTSW 9 107,946,208 (GRCm39) missense probably benign 0.00
R7517:Rnf123 UTSW 9 107,947,473 (GRCm39) nonsense probably null
R7577:Rnf123 UTSW 9 107,947,818 (GRCm39) missense probably damaging 1.00
R8296:Rnf123 UTSW 9 107,940,089 (GRCm39) missense probably damaging 1.00
R8322:Rnf123 UTSW 9 107,945,706 (GRCm39) missense probably benign 0.26
R8754:Rnf123 UTSW 9 107,948,363 (GRCm39) missense probably damaging 1.00
R8783:Rnf123 UTSW 9 107,946,272 (GRCm39) missense probably benign
R9052:Rnf123 UTSW 9 107,936,930 (GRCm39) missense probably damaging 1.00
R9156:Rnf123 UTSW 9 107,940,227 (GRCm39) splice site probably benign
R9170:Rnf123 UTSW 9 107,948,375 (GRCm39) missense probably damaging 1.00
R9332:Rnf123 UTSW 9 107,944,704 (GRCm39) missense probably benign 0.00
R9385:Rnf123 UTSW 9 107,929,467 (GRCm39) missense probably benign 0.02
R9394:Rnf123 UTSW 9 107,942,905 (GRCm39) missense probably damaging 1.00
R9432:Rnf123 UTSW 9 107,937,008 (GRCm39) missense probably damaging 0.96
R9717:Rnf123 UTSW 9 107,954,963 (GRCm39) missense probably benign 0.43
Z1176:Rnf123 UTSW 9 107,940,180 (GRCm39) missense probably damaging 1.00
Z1176:Rnf123 UTSW 9 107,935,594 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGCCTACACGGAGAGAAG -3'
(R):5'- CCTCCTGCTGCTAGTTGTAG -3'

Sequencing Primer
(F):5'- AAGCCGGACCTGGGTCATAC -3'
(R):5'- AGGGGCCCTCTGAGATGTAGAC -3'
Posted On 2015-04-17