Incidental Mutation 'R3940:Pcdhb7'
ID307423
Institutional Source Beutler Lab
Gene Symbol Pcdhb7
Ensembl Gene ENSMUSG00000045062
Gene Nameprotocadherin beta 7
SynonymsPcdhb4B, PcdhbG
MMRRC Submission 040922-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R3940 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37341702-37345202 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37343968 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 719 (L719P)
Ref Sequence ENSEMBL: ENSMUSP00000051041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053037] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably damaging
Transcript: ENSMUST00000053037
AA Change: L719P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051041
Gene: ENSMUSG00000045062
AA Change: L719P

DomainStartEndE-ValueType
Pfam:Cadherin_2 61 143 1.4e-32 PFAM
CA 186 271 5.47e-17 SMART
CA 295 376 4.43e-26 SMART
CA 399 480 1.04e-22 SMART
CA 504 590 2.12e-23 SMART
CA 620 701 5.73e-11 SMART
Pfam:Cadherin_C_2 718 801 5.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.4351 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 95% (35/37)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Acsm3 A G 7: 119,773,886 E204G probably benign Het
Acta2 A T 19: 34,243,480 I276N possibly damaging Het
Ankrd16 T C 2: 11,784,381 C260R probably benign Het
Ankrd42 T C 7: 92,591,788 probably null Het
Atp13a2 T C 4: 141,006,422 S1041P probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Calm5 A T 13: 3,854,485 I37F possibly damaging Het
Casq1 A G 1: 172,219,536 V52A possibly damaging Het
Col22a1 A T 15: 71,981,933 L260* probably null Het
Cttnbp2 C A 6: 18,420,975 V846L probably benign Het
Dnah12 A G 14: 26,723,599 T627A probably benign Het
Eogt T C 6: 97,113,914 I421M probably damaging Het
Fam135a T A 1: 24,057,475 H63L probably damaging Het
Fmo3 T A 1: 162,963,986 T241S probably benign Het
Frem3 T C 8: 80,615,020 I1314T possibly damaging Het
Gm14393 T C 2: 175,061,627 probably null Het
Kcna5 C T 6: 126,533,651 V505I probably damaging Het
Kit A G 5: 75,609,318 D130G probably benign Het
Neto2 G A 8: 85,674,118 T16I probably damaging Het
Olfr1090 T A 2: 86,753,931 D269V possibly damaging Het
Olfr57 T A 10: 79,035,204 I136N probably damaging Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pik3ip1 A G 11: 3,331,987 N48S probably damaging Het
Pkn2 G A 3: 142,793,911 S951L probably damaging Het
Prrc2a T C 17: 35,157,498 H772R possibly damaging Het
Ric1 T C 19: 29,570,762 Y277H probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf123 A T 9: 108,064,035 probably benign Het
Robo1 T C 16: 73,009,743 S1166P probably benign Het
S100a10 A G 3: 93,561,076 E38G probably benign Het
Slc34a1 A T 13: 55,413,170 I483F probably damaging Het
Stim1 A G 7: 102,435,641 N600S probably benign Het
Ube3c T A 5: 29,619,360 N517K probably benign Het
Other mutations in Pcdhb7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01668:Pcdhb7 APN 18 37343152 missense probably benign 0.35
IGL01806:Pcdhb7 APN 18 37342495 missense possibly damaging 0.60
IGL01862:Pcdhb7 APN 18 37343862 missense possibly damaging 0.81
IGL01961:Pcdhb7 APN 18 37342473 missense probably damaging 1.00
R0184:Pcdhb7 UTSW 18 37343390 missense probably benign 0.44
R0426:Pcdhb7 UTSW 18 37342804 missense probably damaging 0.99
R0576:Pcdhb7 UTSW 18 37342357 missense probably benign 0.01
R0646:Pcdhb7 UTSW 18 37343389 missense probably damaging 1.00
R0656:Pcdhb7 UTSW 18 37341901 missense probably benign 0.01
R1216:Pcdhb7 UTSW 18 37343874 missense probably damaging 0.99
R1851:Pcdhb7 UTSW 18 37342578 missense possibly damaging 0.69
R2168:Pcdhb7 UTSW 18 37343282 missense probably benign 0.05
R2312:Pcdhb7 UTSW 18 37342197 missense probably benign
R3153:Pcdhb7 UTSW 18 37343073 missense probably damaging 1.00
R3758:Pcdhb7 UTSW 18 37343026 missense possibly damaging 0.84
R3763:Pcdhb7 UTSW 18 37341883 missense probably benign
R3949:Pcdhb7 UTSW 18 37343088 missense probably benign 0.00
R4418:Pcdhb7 UTSW 18 37343482 missense probably benign 0.08
R4580:Pcdhb7 UTSW 18 37342135 missense probably damaging 1.00
R4880:Pcdhb7 UTSW 18 37342231 missense probably benign 0.00
R4936:Pcdhb7 UTSW 18 37342149 nonsense probably null
R4936:Pcdhb7 UTSW 18 37342150 missense probably damaging 1.00
R5086:Pcdhb7 UTSW 18 37343109 missense possibly damaging 0.56
R5517:Pcdhb7 UTSW 18 37341793 intron probably benign
R5570:Pcdhb7 UTSW 18 37344171 missense probably benign 0.35
R5827:Pcdhb7 UTSW 18 37342024 missense probably benign 0.14
R6187:Pcdhb7 UTSW 18 37342569 missense probably benign 0.23
R6194:Pcdhb7 UTSW 18 37342146 missense probably damaging 0.98
R6195:Pcdhb7 UTSW 18 37342656 missense probably benign 0.33
R6373:Pcdhb7 UTSW 18 37342211 nonsense probably null
R6398:Pcdhb7 UTSW 18 37343434 missense possibly damaging 0.86
R6437:Pcdhb7 UTSW 18 37342690 missense probably damaging 0.96
R6587:Pcdhb7 UTSW 18 37344103 missense probably benign
R6596:Pcdhb7 UTSW 18 37343361 missense probably damaging 0.97
R6646:Pcdhb7 UTSW 18 37343974 missense possibly damaging 0.90
R6702:Pcdhb7 UTSW 18 37341906 missense probably benign 0.03
R6923:Pcdhb7 UTSW 18 37342469 intron probably null
R6976:Pcdhb7 UTSW 18 37343578 missense probably benign 0.12
R7038:Pcdhb7 UTSW 18 37342204 missense possibly damaging 0.90
R7325:Pcdhb7 UTSW 18 37343387 missense probably benign 0.00
R7509:Pcdhb7 UTSW 18 37342021 missense possibly damaging 0.68
R7598:Pcdhb7 UTSW 18 37342780 missense probably damaging 1.00
R7622:Pcdhb7 UTSW 18 37342461 missense probably benign 0.06
R7828:Pcdhb7 UTSW 18 37343862 missense probably damaging 1.00
Z1177:Pcdhb7 UTSW 18 37343208 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- ATTCCAGCTGCTCAAAGCC -3'
(R):5'- TGCCACTGACATCCACCATG -3'

Sequencing Primer
(F):5'- TCACAATGGCGAGGTGC -3'
(R):5'- CCATGTGGCCAGGAAAGAGTTC -3'
Posted On2015-04-17