Incidental Mutation 'R3940:4930567H17Rik'
ID307426
Institutional Source Beutler Lab
Gene Symbol 4930567H17Rik
Ensembl Gene ENSMUSG00000073141
Gene NameRIKEN cDNA 4930567H17 gene
Synonyms
MMRRC Submission 040922-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.032) question?
Stock #R3940 (G1)
Quality Score96
Status Not validated
ChromosomeX
Chromosomal Location70393901-70394740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 70394529 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 53 (A53T)
Ref Sequence ENSEMBL: ENSMUSP00000090060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092405]
Predicted Effect probably benign
Transcript: ENSMUST00000092405
AA Change: A53T

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000090060
Gene: ENSMUSG00000073141
AA Change: A53T

DomainStartEndE-ValueType
SCOP:d1sig__ 115 223 1e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193512
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 95% (35/37)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 A G 7: 119,773,886 E204G probably benign Het
Acta2 A T 19: 34,243,480 I276N possibly damaging Het
Ankrd16 T C 2: 11,784,381 C260R probably benign Het
Ankrd42 T C 7: 92,591,788 probably null Het
Atp13a2 T C 4: 141,006,422 S1041P probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Calm5 A T 13: 3,854,485 I37F possibly damaging Het
Casq1 A G 1: 172,219,536 V52A possibly damaging Het
Col22a1 A T 15: 71,981,933 L260* probably null Het
Cttnbp2 C A 6: 18,420,975 V846L probably benign Het
Dnah12 A G 14: 26,723,599 T627A probably benign Het
Eogt T C 6: 97,113,914 I421M probably damaging Het
Fam135a T A 1: 24,057,475 H63L probably damaging Het
Fmo3 T A 1: 162,963,986 T241S probably benign Het
Frem3 T C 8: 80,615,020 I1314T possibly damaging Het
Gm14393 T C 2: 175,061,627 probably null Het
Kcna5 C T 6: 126,533,651 V505I probably damaging Het
Kit A G 5: 75,609,318 D130G probably benign Het
Neto2 G A 8: 85,674,118 T16I probably damaging Het
Olfr1090 T A 2: 86,753,931 D269V possibly damaging Het
Olfr57 T A 10: 79,035,204 I136N probably damaging Het
Pcdhb7 T C 18: 37,343,968 L719P probably damaging Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pik3ip1 A G 11: 3,331,987 N48S probably damaging Het
Pkn2 G A 3: 142,793,911 S951L probably damaging Het
Prrc2a T C 17: 35,157,498 H772R possibly damaging Het
Ric1 T C 19: 29,570,762 Y277H probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf123 A T 9: 108,064,035 probably benign Het
Robo1 T C 16: 73,009,743 S1166P probably benign Het
S100a10 A G 3: 93,561,076 E38G probably benign Het
Slc34a1 A T 13: 55,413,170 I483F probably damaging Het
Stim1 A G 7: 102,435,641 N600S probably benign Het
Ube3c T A 5: 29,619,360 N517K probably benign Het
Other mutations in 4930567H17Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0737:4930567H17Rik UTSW X 70394207 unclassified probably benign
R2257:4930567H17Rik UTSW X 70394406 missense probably damaging 1.00
R3919:4930567H17Rik UTSW X 70394529 missense probably benign 0.07
R3939:4930567H17Rik UTSW X 70394529 missense probably benign 0.07
R4231:4930567H17Rik UTSW X 70394529 missense probably benign 0.07
R4232:4930567H17Rik UTSW X 70394529 missense probably benign 0.07
R4234:4930567H17Rik UTSW X 70394529 missense probably benign 0.07
R4235:4930567H17Rik UTSW X 70394529 missense probably benign 0.07
R4236:4930567H17Rik UTSW X 70394529 missense probably benign 0.07
R8139:4930567H17Rik UTSW X 70394514 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GCAGCTTTCAGGATGTATCTGC -3'
(R):5'- CACTACTGGTCGAACAACTGTC -3'

Sequencing Primer
(F):5'- CTGCATGGGTCGTATGAAGAC -3'
(R):5'- CTGTCTTAGAAAGTCAGGCAGTC -3'
Posted On2015-04-17