Incidental Mutation 'R3941:Cr2'
ID307430
Institutional Source Beutler Lab
Gene Symbol Cr2
Ensembl Gene ENSMUSG00000026616
Gene Namecomplement receptor 2
SynonymsC3DR, CD21, Cr-1, Cr1, CD35, Cr-2
MMRRC Submission 040923-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R3941 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location195136811-195176716 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 195165814 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 345 (H345Q)
Ref Sequence ENSEMBL: ENSMUSP00000147804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043104] [ENSMUST00000082321] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043104
AA Change: H325Q

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044261
Gene: ENSMUSG00000026616
AA Change: H325Q

DomainStartEndE-ValueType
CCP 2 58 5.04e-7 SMART
CCP 63 120 3.58e-12 SMART
CCP 125 191 1.2e-13 SMART
CCP 197 252 2.73e-17 SMART
CCP 256 311 1.01e-15 SMART
Blast:CCP 316 347 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000082321
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193801
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194149
Predicted Effect probably benign
Transcript: ENSMUST00000195120
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195722
Predicted Effect probably damaging
Transcript: ENSMUST00000210219
AA Change: H345Q

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.3802 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610203C20Rik T C 9: 41,590,274 L143P probably damaging Het
Abcc1 A T 16: 14,396,399 T193S probably benign Het
Arhgap11a A T 2: 113,836,897 L435Q probably damaging Het
Bin1 T C 18: 32,406,158 V48A probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Btn1a1 T G 13: 23,459,264 R338S probably benign Het
Cacnb4 C A 2: 52,469,489 R169L probably damaging Het
Ccdc80 A G 16: 45,096,092 T404A probably benign Het
Cd2ap G C 17: 42,808,799 H488D probably damaging Het
Cdon A G 9: 35,464,171 T498A probably benign Het
Cngb3 A G 4: 19,396,786 N380D probably benign Het
Col6a5 G A 9: 105,939,834 S426F unknown Het
Cttnbp2 T A 6: 18,427,453 K743M probably benign Het
Depdc1b T C 13: 108,368,836 S245P probably damaging Het
Dync2h1 G A 9: 7,124,825 H2016Y probably benign Het
Eif2s3y G T Y: 1,012,079 R98L probably benign Het
Eml6 C T 11: 29,803,167 G915S probably damaging Het
Fcgr1 A G 3: 96,286,033 L216P probably benign Het
Fpr-rs3 T C 17: 20,624,849 N10S probably benign Het
Frem3 T C 8: 80,615,020 I1314T possibly damaging Het
Gabrr3 A G 16: 59,433,501 N194D probably damaging Het
Hey1 A G 3: 8,664,578 L273P probably damaging Het
Irf6 A G 1: 193,168,549 K365E probably benign Het
Kit A G 5: 75,609,318 D130G probably benign Het
Lrp1 G A 10: 127,553,396 A3217V probably damaging Het
Mei4 C T 9: 81,927,283 R140C probably benign Het
Mpo A T 11: 87,797,349 K278M probably benign Het
Mprip T C 11: 59,731,502 probably benign Het
Mug2 G C 6: 122,063,563 G691R probably benign Het
Neto2 G A 8: 85,674,118 T16I probably damaging Het
Nipal4 C T 11: 46,150,646 V241M probably damaging Het
Nlrp2 A T 7: 5,327,552 L615* probably null Het
Pcdh1 A G 18: 38,199,458 V164A probably benign Het
Phc2 T C 4: 128,747,244 probably null Het
Plekhg3 A G 12: 76,573,359 E623G probably damaging Het
Psors1c2 G T 17: 35,533,928 G29* probably null Het
Slc25a54 A T 3: 109,112,163 D361V probably damaging Het
Slc39a12 A T 2: 14,396,181 H123L possibly damaging Het
Sorl1 T C 9: 41,989,468 probably null Het
Strn A T 17: 78,657,940 I641N probably damaging Het
Tapbp A G 17: 33,920,483 E151G possibly damaging Het
Ticrr T C 7: 79,693,697 probably benign Het
Tnfrsf21 G A 17: 43,038,010 C171Y probably damaging Het
Ttyh1 T A 7: 4,129,318 L155H probably damaging Het
Utrn T A 10: 12,711,585 probably null Het
Vmn1r175 A G 7: 23,808,968 V78A probably benign Het
Vmn1r73 T C 7: 11,756,755 Y167H probably damaging Het
Washc1 T C 17: 66,118,128 S376P probably damaging Het
Wnt10a T A 1: 74,803,497 probably null Het
Xrcc4 A G 13: 90,071,633 V16A probably benign Het
Zeb1 T C 18: 5,767,799 V770A probably benign Het
Zfp410 A G 12: 84,338,753 N90S probably damaging Het
Other mutations in Cr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 195154251 missense possibly damaging 0.76
IGL01326:Cr2 APN 1 195141221 missense probably null 1.00
IGL01358:Cr2 APN 1 195159820 missense probably damaging 1.00
IGL01410:Cr2 APN 1 195163234 missense possibly damaging 0.49
IGL01468:Cr2 APN 1 195168535 missense probably damaging 1.00
IGL01608:Cr2 APN 1 195155220 missense possibly damaging 0.50
IGL01810:Cr2 APN 1 195159595 missense possibly damaging 0.49
IGL01843:Cr2 APN 1 195150914 splice site probably benign
IGL02332:Cr2 APN 1 195160322 missense probably benign 0.19
IGL02934:Cr2 APN 1 195154325 splice site probably benign
IGL02938:Cr2 APN 1 195166388 missense probably damaging 1.00
IGL03149:Cr2 APN 1 195166366 missense probably damaging 1.00
IGL03327:Cr2 APN 1 195169759 missense probably damaging 1.00
IGL03346:Cr2 APN 1 195169759 missense probably damaging 1.00
Pillar UTSW 1 195155888 nonsense probably null
PIT4354001:Cr2 UTSW 1 195166309 missense probably damaging 1.00
PIT4418001:Cr2 UTSW 1 195157452 missense probably benign 0.08
R0128:Cr2 UTSW 1 195166231 missense probably damaging 0.99
R0130:Cr2 UTSW 1 195166231 missense probably damaging 0.99
R0380:Cr2 UTSW 1 195157407 missense probably damaging 1.00
R0538:Cr2 UTSW 1 195160359 splice site probably benign
R0605:Cr2 UTSW 1 195163596 splice site probably benign
R0626:Cr2 UTSW 1 195171111 missense possibly damaging 0.95
R1135:Cr2 UTSW 1 195157190 missense probably damaging 1.00
R1396:Cr2 UTSW 1 195169253 splice site probably null
R1422:Cr2 UTSW 1 195171125 missense probably benign 0.01
R1467:Cr2 UTSW 1 195157509 missense probably damaging 1.00
R1467:Cr2 UTSW 1 195157509 missense probably damaging 1.00
R1511:Cr2 UTSW 1 195155272 missense possibly damaging 0.92
R1572:Cr2 UTSW 1 195163314 missense probably damaging 1.00
R1714:Cr2 UTSW 1 195151686 missense possibly damaging 0.46
R1748:Cr2 UTSW 1 195155905 nonsense probably null
R1761:Cr2 UTSW 1 195155123 critical splice donor site probably null
R1824:Cr2 UTSW 1 195157316 missense probably damaging 1.00
R1893:Cr2 UTSW 1 195155187 missense probably benign 0.03
R1990:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R1991:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R1992:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R2191:Cr2 UTSW 1 195163381 missense possibly damaging 0.94
R2276:Cr2 UTSW 1 195157368 missense possibly damaging 0.94
R2277:Cr2 UTSW 1 195157368 missense possibly damaging 0.94
R3548:Cr2 UTSW 1 195155888 nonsense probably null
R3743:Cr2 UTSW 1 195149966 splice site probably benign
R3963:Cr2 UTSW 1 195159739 missense probably damaging 1.00
R4211:Cr2 UTSW 1 195156328 missense probably damaging 0.96
R4484:Cr2 UTSW 1 195154174 missense probably damaging 1.00
R4546:Cr2 UTSW 1 195171041 missense possibly damaging 0.94
R4791:Cr2 UTSW 1 195155935 missense probably damaging 1.00
R4801:Cr2 UTSW 1 195163311 missense probably damaging 1.00
R4802:Cr2 UTSW 1 195163311 missense probably damaging 1.00
R4874:Cr2 UTSW 1 195176570 missense possibly damaging 0.82
R4885:Cr2 UTSW 1 195158731 missense possibly damaging 0.92
R4889:Cr2 UTSW 1 195176585 missense possibly damaging 0.70
R5154:Cr2 UTSW 1 195159446 missense probably damaging 1.00
R5574:Cr2 UTSW 1 195141236 missense probably damaging 1.00
R5594:Cr2 UTSW 1 195157190 missense probably damaging 1.00
R5645:Cr2 UTSW 1 195154273 missense probably damaging 1.00
R5700:Cr2 UTSW 1 195159757 missense probably damaging 0.96
R5929:Cr2 UTSW 1 195171111 missense possibly damaging 0.91
R6237:Cr2 UTSW 1 195157502 missense probably damaging 1.00
R6299:Cr2 UTSW 1 195168646 missense probably damaging 1.00
R6368:Cr2 UTSW 1 195168472 missense probably damaging 1.00
R6406:Cr2 UTSW 1 195169771 missense probably damaging 1.00
R6618:Cr2 UTSW 1 195157379 missense probably damaging 0.98
R6684:Cr2 UTSW 1 195171021 nonsense probably null
R6720:Cr2 UTSW 1 195155200 missense probably damaging 0.97
R6866:Cr2 UTSW 1 195151691 missense probably damaging 1.00
R6915:Cr2 UTSW 1 195171146 missense probably benign 0.06
R7057:Cr2 UTSW 1 195151610 missense possibly damaging 0.83
R7117:Cr2 UTSW 1 195160601 missense possibly damaging 0.79
R7200:Cr2 UTSW 1 195163249 missense probably damaging 1.00
R7209:Cr2 UTSW 1 195168724 missense probably damaging 1.00
R7350:Cr2 UTSW 1 195155286 missense probably benign 0.21
R7414:Cr2 UTSW 1 195150036 missense probably benign
R7453:Cr2 UTSW 1 195165257 splice site probably null
R7479:Cr2 UTSW 1 195158410 critical splice donor site probably null
R7480:Cr2 UTSW 1 195154176 missense probably damaging 1.00
R7570:Cr2 UTSW 1 195169340 nonsense probably null
R7666:Cr2 UTSW 1 195154225 missense probably damaging 1.00
R7921:Cr2 UTSW 1 195151667 missense possibly damaging 0.94
R7923:Cr2 UTSW 1 195168687 missense probably benign 0.03
R8396:Cr2 UTSW 1 195158068 missense probably damaging 1.00
R8503:Cr2 UTSW 1 195163542 missense probably benign
R8517:Cr2 UTSW 1 195155899 missense probably benign 0.03
X0028:Cr2 UTSW 1 195149982 missense probably benign 0.09
X0066:Cr2 UTSW 1 195166321 missense probably damaging 0.99
Z1176:Cr2 UTSW 1 195154153 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TGGCAGAGTTCTTAGTCAGAAAAGG -3'
(R):5'- AGTCCCGACATGTGAAGGTG -3'

Sequencing Primer
(F):5'- CAATCAGTGCAGGTCCTAT -3'
(R):5'- CCCGACATGTGAAGGTGCTTATAG -3'
Posted On2015-04-17