Incidental Mutation 'R3941:Fcgr1'
ID 307436
Institutional Source Beutler Lab
Gene Symbol Fcgr1
Ensembl Gene ENSMUSG00000015947
Gene Name Fc receptor, IgG, high affinity I
Synonyms CD64, FcgammaRI
MMRRC Submission 040923-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.254) question?
Stock # R3941 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 96282909-96293969 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 96286033 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 216 (L216P)
Ref Sequence ENSEMBL: ENSMUSP00000029748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029748]
AlphaFold P26151
Predicted Effect probably benign
Transcript: ENSMUST00000029748
AA Change: L216P

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000029748
Gene: ENSMUSG00000015947
AA Change: L216P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 38 111 1.8e-5 SMART
IGc2 125 184 6.11e-8 SMART
IG 206 290 7.3e-6 SMART
transmembrane domain 298 320 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200420
Meta Mutation Damage Score 0.1932 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays an important role in the immune response. This protein is a high-affinity Fc-gamma receptor. The gene is one of three related gene family members located on chromosome 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results immune response defects including a decreased inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610203C20Rik T C 9: 41,590,274 L143P probably damaging Het
Abcc1 A T 16: 14,396,399 T193S probably benign Het
Arhgap11a A T 2: 113,836,897 L435Q probably damaging Het
Bin1 T C 18: 32,406,158 V48A probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Btn1a1 T G 13: 23,459,264 R338S probably benign Het
Cacnb4 C A 2: 52,469,489 R169L probably damaging Het
Ccdc80 A G 16: 45,096,092 T404A probably benign Het
Cd2ap G C 17: 42,808,799 H488D probably damaging Het
Cdon A G 9: 35,464,171 T498A probably benign Het
Cngb3 A G 4: 19,396,786 N380D probably benign Het
Col6a5 G A 9: 105,939,834 S426F unknown Het
Cr2 A T 1: 195,165,814 H345Q probably damaging Het
Cttnbp2 T A 6: 18,427,453 K743M probably benign Het
Depdc1b T C 13: 108,368,836 S245P probably damaging Het
Dync2h1 G A 9: 7,124,825 H2016Y probably benign Het
Eif2s3y G T Y: 1,012,079 R98L probably benign Het
Eml6 C T 11: 29,803,167 G915S probably damaging Het
Fpr-rs3 T C 17: 20,624,849 N10S probably benign Het
Frem3 T C 8: 80,615,020 I1314T possibly damaging Het
Gabrr3 A G 16: 59,433,501 N194D probably damaging Het
Hey1 A G 3: 8,664,578 L273P probably damaging Het
Irf6 A G 1: 193,168,549 K365E probably benign Het
Kit A G 5: 75,609,318 D130G probably benign Het
Lrp1 G A 10: 127,553,396 A3217V probably damaging Het
Mei4 C T 9: 81,927,283 R140C probably benign Het
Mpo A T 11: 87,797,349 K278M probably benign Het
Mprip T C 11: 59,731,502 probably benign Het
Mug2 G C 6: 122,063,563 G691R probably benign Het
Neto2 G A 8: 85,674,118 T16I probably damaging Het
Nipal4 C T 11: 46,150,646 V241M probably damaging Het
Nlrp2 A T 7: 5,327,552 L615* probably null Het
Pcdh1 A G 18: 38,199,458 V164A probably benign Het
Phc2 T C 4: 128,747,244 probably null Het
Plekhg3 A G 12: 76,573,359 E623G probably damaging Het
Psors1c2 G T 17: 35,533,928 G29* probably null Het
Slc25a54 A T 3: 109,112,163 D361V probably damaging Het
Slc39a12 A T 2: 14,396,181 H123L possibly damaging Het
Sorl1 T C 9: 41,989,468 probably null Het
Strn A T 17: 78,657,940 I641N probably damaging Het
Tapbp A G 17: 33,920,483 E151G possibly damaging Het
Ticrr T C 7: 79,693,697 probably benign Het
Tnfrsf21 G A 17: 43,038,010 C171Y probably damaging Het
Ttyh1 T A 7: 4,129,318 L155H probably damaging Het
Utrn T A 10: 12,711,585 probably null Het
Vmn1r175 A G 7: 23,808,968 V78A probably benign Het
Vmn1r73 T C 7: 11,756,755 Y167H probably damaging Het
Washc1 T C 17: 66,118,128 S376P probably damaging Het
Wnt10a T A 1: 74,803,497 probably null Het
Xrcc4 A G 13: 90,071,633 V16A probably benign Het
Zeb1 T C 18: 5,767,799 V770A probably benign Het
Zfp410 A G 12: 84,338,753 N90S probably damaging Het
Other mutations in Fcgr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01490:Fcgr1 APN 3 96284370 missense probably benign 0.01
IGL02142:Fcgr1 APN 3 96284577 missense probably benign 0.41
IGL03086:Fcgr1 APN 3 96284498 nonsense probably null
F5770:Fcgr1 UTSW 3 96284276 makesense probably null
FR4737:Fcgr1 UTSW 3 96284504 frame shift probably null
FR4737:Fcgr1 UTSW 3 96287094 missense probably benign 0.01
R0323:Fcgr1 UTSW 3 96285829 missense possibly damaging 0.84
R0594:Fcgr1 UTSW 3 96292312 missense probably damaging 1.00
R0926:Fcgr1 UTSW 3 96292366 missense possibly damaging 0.79
R1951:Fcgr1 UTSW 3 96287070 missense probably damaging 1.00
R1953:Fcgr1 UTSW 3 96287070 missense probably damaging 1.00
R1993:Fcgr1 UTSW 3 96285868 missense probably damaging 0.98
R2255:Fcgr1 UTSW 3 96285917 missense possibly damaging 0.88
R4004:Fcgr1 UTSW 3 96284352 missense probably benign 0.00
R4409:Fcgr1 UTSW 3 96284577 missense probably benign 0.41
R5046:Fcgr1 UTSW 3 96286986 missense probably damaging 0.99
R5047:Fcgr1 UTSW 3 96285884 missense probably benign 0.38
R6970:Fcgr1 UTSW 3 96284620 critical splice acceptor site probably null
R7339:Fcgr1 UTSW 3 96284299 missense not run
R7992:Fcgr1 UTSW 3 96284581 missense probably benign 0.23
R8554:Fcgr1 UTSW 3 96292472 missense probably damaging 1.00
R9269:Fcgr1 UTSW 3 96285838 missense probably benign 0.01
R9396:Fcgr1 UTSW 3 96287074 nonsense probably null
V7581:Fcgr1 UTSW 3 96284276 makesense probably null
V7582:Fcgr1 UTSW 3 96284276 makesense probably null
V7583:Fcgr1 UTSW 3 96284276 makesense probably null
X0028:Fcgr1 UTSW 3 96286027 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- AACTCAGGGCTGCGCTTAAG -3'
(R):5'- GTCACGGCTTTTAGAAATCATGC -3'

Sequencing Primer
(F):5'- TGCGCTTAAGGACACTGCTG -3'
(R):5'- AGAAATCATGCCTCTCTGCTGG -3'
Posted On 2015-04-17