Incidental Mutation 'R3941:Vmn1r73'
ID307445
Institutional Source Beutler Lab
Gene Symbol Vmn1r73
Ensembl Gene ENSMUSG00000051687
Gene Namevomeronasal 1 receptor 73
SynonymsV1rg2
MMRRC Submission 040923-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R3941 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location11730266-11762081 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11756755 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 167 (Y167H)
Ref Sequence ENSEMBL: ENSMUSP00000153827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055070] [ENSMUST00000226516]
Predicted Effect probably damaging
Transcript: ENSMUST00000055070
AA Change: Y167H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055353
Gene: ENSMUSG00000051687
AA Change: Y167H

DomainStartEndE-ValueType
Pfam:TAS2R 1 301 7.5e-7 PFAM
Pfam:V1R 32 297 1.9e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226516
AA Change: Y167H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610203C20Rik T C 9: 41,590,274 L143P probably damaging Het
Abcc1 A T 16: 14,396,399 T193S probably benign Het
Arhgap11a A T 2: 113,836,897 L435Q probably damaging Het
Bin1 T C 18: 32,406,158 V48A probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Btn1a1 T G 13: 23,459,264 R338S probably benign Het
Cacnb4 C A 2: 52,469,489 R169L probably damaging Het
Ccdc80 A G 16: 45,096,092 T404A probably benign Het
Cd2ap G C 17: 42,808,799 H488D probably damaging Het
Cdon A G 9: 35,464,171 T498A probably benign Het
Cngb3 A G 4: 19,396,786 N380D probably benign Het
Col6a5 G A 9: 105,939,834 S426F unknown Het
Cr2 A T 1: 195,165,814 H345Q probably damaging Het
Cttnbp2 T A 6: 18,427,453 K743M probably benign Het
Depdc1b T C 13: 108,368,836 S245P probably damaging Het
Dync2h1 G A 9: 7,124,825 H2016Y probably benign Het
Eif2s3y G T Y: 1,012,079 R98L probably benign Het
Eml6 C T 11: 29,803,167 G915S probably damaging Het
Fcgr1 A G 3: 96,286,033 L216P probably benign Het
Fpr-rs3 T C 17: 20,624,849 N10S probably benign Het
Frem3 T C 8: 80,615,020 I1314T possibly damaging Het
Gabrr3 A G 16: 59,433,501 N194D probably damaging Het
Hey1 A G 3: 8,664,578 L273P probably damaging Het
Irf6 A G 1: 193,168,549 K365E probably benign Het
Kit A G 5: 75,609,318 D130G probably benign Het
Lrp1 G A 10: 127,553,396 A3217V probably damaging Het
Mei4 C T 9: 81,927,283 R140C probably benign Het
Mpo A T 11: 87,797,349 K278M probably benign Het
Mprip T C 11: 59,731,502 probably benign Het
Mug2 G C 6: 122,063,563 G691R probably benign Het
Neto2 G A 8: 85,674,118 T16I probably damaging Het
Nipal4 C T 11: 46,150,646 V241M probably damaging Het
Nlrp2 A T 7: 5,327,552 L615* probably null Het
Pcdh1 A G 18: 38,199,458 V164A probably benign Het
Phc2 T C 4: 128,747,244 probably null Het
Plekhg3 A G 12: 76,573,359 E623G probably damaging Het
Psors1c2 G T 17: 35,533,928 G29* probably null Het
Slc25a54 A T 3: 109,112,163 D361V probably damaging Het
Slc39a12 A T 2: 14,396,181 H123L possibly damaging Het
Sorl1 T C 9: 41,989,468 probably null Het
Strn A T 17: 78,657,940 I641N probably damaging Het
Tapbp A G 17: 33,920,483 E151G possibly damaging Het
Ticrr T C 7: 79,693,697 probably benign Het
Tnfrsf21 G A 17: 43,038,010 C171Y probably damaging Het
Ttyh1 T A 7: 4,129,318 L155H probably damaging Het
Utrn T A 10: 12,711,585 probably null Het
Vmn1r175 A G 7: 23,808,968 V78A probably benign Het
Washc1 T C 17: 66,118,128 S376P probably damaging Het
Wnt10a T A 1: 74,803,497 probably null Het
Xrcc4 A G 13: 90,071,633 V16A probably benign Het
Zeb1 T C 18: 5,767,799 V770A probably benign Het
Zfp410 A G 12: 84,338,753 N90S probably damaging Het
Other mutations in Vmn1r73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Vmn1r73 APN 7 11756738 missense probably benign 0.02
IGL02337:Vmn1r73 APN 7 11756713 missense possibly damaging 0.69
IGL02666:Vmn1r73 APN 7 11756938 missense probably damaging 1.00
IGL02741:Vmn1r73 APN 7 11756783 missense probably benign 0.05
IGL02756:Vmn1r73 APN 7 11756647 missense possibly damaging 0.95
IGL03113:Vmn1r73 APN 7 11756600 missense probably benign
IGL03195:Vmn1r73 APN 7 11757080 missense probably damaging 1.00
R0023:Vmn1r73 UTSW 7 11757070 missense probably benign 0.43
R0379:Vmn1r73 UTSW 7 11756846 missense probably benign 0.16
R4224:Vmn1r73 UTSW 7 11756579 missense probably damaging 0.99
R4631:Vmn1r73 UTSW 7 11756831 missense probably benign 0.22
R4912:Vmn1r73 UTSW 7 11756669 missense probably damaging 0.99
R5060:Vmn1r73 UTSW 7 11756756 missense probably damaging 1.00
R5450:Vmn1r73 UTSW 7 11756449 missense possibly damaging 0.63
R5609:Vmn1r73 UTSW 7 11756664 nonsense probably null
R6059:Vmn1r73 UTSW 7 11756611 missense probably benign 0.40
R6508:Vmn1r73 UTSW 7 11756704 missense possibly damaging 0.73
R6967:Vmn1r73 UTSW 7 11756617 nonsense probably null
R7099:Vmn1r73 UTSW 7 11756393 missense probably damaging 1.00
R7304:Vmn1r73 UTSW 7 11756897 missense probably damaging 1.00
R7579:Vmn1r73 UTSW 7 11757155 missense probably benign 0.08
R7891:Vmn1r73 UTSW 7 11757109 missense possibly damaging 0.87
Z1176:Vmn1r73 UTSW 7 11756956 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AATGTGCATACTGAGTTGCTTC -3'
(R):5'- GCTCTGTTTTCAGGTGAAGC -3'

Sequencing Primer
(F):5'- TTCCAAGCAATCACAATTAGCC -3'
(R):5'- TTCAGGTGAAGCATTTAGAAAGTGC -3'
Posted On2015-04-17