Incidental Mutation 'R3941:Neto2'
ID 307449
Institutional Source Beutler Lab
Gene Symbol Neto2
Ensembl Gene ENSMUSG00000036902
Gene Name neuropilin (NRP) and tolloid (TLL)-like 2
Synonyms 5530601C23Rik
MMRRC Submission 040923-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.164) question?
Stock # R3941 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 86363217-86427553 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 86400747 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 16 (T16I)
Ref Sequence ENSEMBL: ENSMUSP00000148172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109686] [ENSMUST00000209479] [ENSMUST00000216286]
AlphaFold Q8BNJ6
Predicted Effect possibly damaging
Transcript: ENSMUST00000109686
AA Change: T51I

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105308
Gene: ENSMUSG00000036902
AA Change: T51I

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
CUB 80 194 2.56e-40 SMART
CUB 205 320 9.11e-5 SMART
LDLa 324 361 5.73e-5 SMART
transmembrane domain 374 396 N/A INTRINSIC
coiled coil region 432 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209259
Predicted Effect probably damaging
Transcript: ENSMUST00000209479
AA Change: T16I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215046
Predicted Effect probably benign
Transcript: ENSMUST00000216286
AA Change: T16I

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0759 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. A similar gene in rats encodes a protein that modulates glutamate signaling in the brain by regulating kainate receptor function. Expression of this gene may be a biomarker for proliferating infantile hemangiomas. A pseudogene of this gene is located on the long arm of chromosome 8. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null mutation show normal brain morphology and kainate receptor mediated excitatory postsynaptic currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A T 16: 14,214,263 (GRCm39) T193S probably benign Het
Arhgap11a A T 2: 113,667,242 (GRCm39) L435Q probably damaging Het
Bin1 T C 18: 32,539,211 (GRCm39) V48A probably damaging Het
Brinp3 C A 1: 146,627,599 (GRCm39) D277E probably damaging Het
Btn1a1 T G 13: 23,643,434 (GRCm39) R338S probably benign Het
Cacnb4 C A 2: 52,359,501 (GRCm39) R169L probably damaging Het
Ccdc80 A G 16: 44,916,455 (GRCm39) T404A probably benign Het
Cd2ap G C 17: 43,119,690 (GRCm39) H488D probably damaging Het
Cdon A G 9: 35,375,467 (GRCm39) T498A probably benign Het
Cngb3 A G 4: 19,396,786 (GRCm39) N380D probably benign Het
Col6a5 G A 9: 105,817,033 (GRCm39) S426F unknown Het
Cr2 A T 1: 194,848,122 (GRCm39) H345Q probably damaging Het
Cttnbp2 T A 6: 18,427,452 (GRCm39) K743M probably benign Het
Depdc1b T C 13: 108,505,370 (GRCm39) S245P probably damaging Het
Dync2h1 G A 9: 7,124,825 (GRCm39) H2016Y probably benign Het
Eif2s3y G T Y: 1,012,079 (GRCm39) R98L probably benign Het
Eml6 C T 11: 29,753,167 (GRCm39) G915S probably damaging Het
Fcgr1 A G 3: 96,193,349 (GRCm39) L216P probably benign Het
Fpr-rs3 T C 17: 20,845,111 (GRCm39) N10S probably benign Het
Frem3 T C 8: 81,341,649 (GRCm39) I1314T possibly damaging Het
Gabrr3 A G 16: 59,253,864 (GRCm39) N194D probably damaging Het
Hey1 A G 3: 8,729,638 (GRCm39) L273P probably damaging Het
Irf6 A G 1: 192,850,857 (GRCm39) K365E probably benign Het
Kit A G 5: 75,769,978 (GRCm39) D130G probably benign Het
Lrp1 G A 10: 127,389,265 (GRCm39) A3217V probably damaging Het
Mei4 C T 9: 81,809,336 (GRCm39) R140C probably benign Het
Mir100hg T C 9: 41,501,570 (GRCm39) L143P probably damaging Het
Mpo A T 11: 87,688,175 (GRCm39) K278M probably benign Het
Mprip T C 11: 59,622,328 (GRCm39) probably benign Het
Mug2 G C 6: 122,040,522 (GRCm39) G691R probably benign Het
Nipal4 C T 11: 46,041,473 (GRCm39) V241M probably damaging Het
Nlrp2 A T 7: 5,330,551 (GRCm39) L615* probably null Het
Pcdh1 A G 18: 38,332,511 (GRCm39) V164A probably benign Het
Phc2 T C 4: 128,641,037 (GRCm39) probably null Het
Plekhg3 A G 12: 76,620,133 (GRCm39) E623G probably damaging Het
Psors1c2 G T 17: 35,844,825 (GRCm39) G29* probably null Het
Slc25a54 A T 3: 109,019,479 (GRCm39) D361V probably damaging Het
Slc39a12 A T 2: 14,400,992 (GRCm39) H123L possibly damaging Het
Sorl1 T C 9: 41,900,764 (GRCm39) probably null Het
Strn A T 17: 78,965,369 (GRCm39) I641N probably damaging Het
Tapbp A G 17: 34,139,457 (GRCm39) E151G possibly damaging Het
Ticrr T C 7: 79,343,445 (GRCm39) probably benign Het
Tnfrsf21 G A 17: 43,348,901 (GRCm39) C171Y probably damaging Het
Ttyh1 T A 7: 4,132,317 (GRCm39) L155H probably damaging Het
Utrn T A 10: 12,587,329 (GRCm39) probably null Het
Vmn1r175 A G 7: 23,508,393 (GRCm39) V78A probably benign Het
Vmn1r73 T C 7: 11,490,682 (GRCm39) Y167H probably damaging Het
Washc1 T C 17: 66,425,123 (GRCm39) S376P probably damaging Het
Wnt10a T A 1: 74,842,656 (GRCm39) probably null Het
Xrcc4 A G 13: 90,219,752 (GRCm39) V16A probably benign Het
Zeb1 T C 18: 5,767,799 (GRCm39) V770A probably benign Het
Zfp410 A G 12: 84,385,527 (GRCm39) N90S probably damaging Het
Other mutations in Neto2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Neto2 APN 8 86,367,632 (GRCm39) missense probably damaging 1.00
IGL01938:Neto2 APN 8 86,417,484 (GRCm39) missense probably benign 0.00
IGL02238:Neto2 APN 8 86,396,292 (GRCm39) missense probably damaging 0.99
IGL02605:Neto2 APN 8 86,390,064 (GRCm39) splice site probably benign
IGL02813:Neto2 APN 8 86,417,515 (GRCm39) missense probably benign
R0138:Neto2 UTSW 8 86,367,673 (GRCm39) missense possibly damaging 0.72
R1934:Neto2 UTSW 8 86,397,033 (GRCm39) missense possibly damaging 0.96
R2402:Neto2 UTSW 8 86,417,541 (GRCm39) missense probably benign 0.00
R2423:Neto2 UTSW 8 86,396,396 (GRCm39) missense probably damaging 1.00
R3821:Neto2 UTSW 8 86,389,924 (GRCm39) nonsense probably null
R3822:Neto2 UTSW 8 86,389,924 (GRCm39) nonsense probably null
R3883:Neto2 UTSW 8 86,389,894 (GRCm39) missense probably damaging 1.00
R3939:Neto2 UTSW 8 86,400,747 (GRCm39) missense probably damaging 0.99
R3940:Neto2 UTSW 8 86,400,747 (GRCm39) missense probably damaging 0.99
R4433:Neto2 UTSW 8 86,367,712 (GRCm39) missense probably damaging 1.00
R4668:Neto2 UTSW 8 86,367,691 (GRCm39) missense probably damaging 1.00
R4675:Neto2 UTSW 8 86,396,333 (GRCm39) missense probably damaging 1.00
R4908:Neto2 UTSW 8 86,396,393 (GRCm39) missense probably damaging 0.99
R5459:Neto2 UTSW 8 86,397,112 (GRCm39) missense probably benign 0.35
R5471:Neto2 UTSW 8 86,367,389 (GRCm39) missense probably benign 0.41
R5544:Neto2 UTSW 8 86,374,506 (GRCm39) missense possibly damaging 0.94
R5571:Neto2 UTSW 8 86,367,173 (GRCm39) missense probably damaging 1.00
R6083:Neto2 UTSW 8 86,367,214 (GRCm39) missense probably benign 0.00
R6339:Neto2 UTSW 8 86,367,187 (GRCm39) missense probably benign 0.33
R6381:Neto2 UTSW 8 86,369,138 (GRCm39) missense probably damaging 0.99
R6572:Neto2 UTSW 8 86,397,033 (GRCm39) missense possibly damaging 0.96
R6593:Neto2 UTSW 8 86,396,175 (GRCm39) missense probably damaging 1.00
R6662:Neto2 UTSW 8 86,389,844 (GRCm39) missense probably damaging 1.00
R6881:Neto2 UTSW 8 86,367,185 (GRCm39) missense probably damaging 1.00
R6950:Neto2 UTSW 8 86,397,072 (GRCm39) missense probably damaging 1.00
R7121:Neto2 UTSW 8 86,397,020 (GRCm39) splice site probably null
R7754:Neto2 UTSW 8 86,396,329 (GRCm39) missense probably damaging 0.98
R7755:Neto2 UTSW 8 86,396,285 (GRCm39) missense probably damaging 1.00
R8682:Neto2 UTSW 8 86,367,295 (GRCm39) missense probably benign 0.01
R9326:Neto2 UTSW 8 86,369,063 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGTCATTGCAATATTCAAGAACAA -3'
(R):5'- AATGCTGGTGAGGACTGGTG -3'

Sequencing Primer
(F):5'- GCTGTACAATGTGAGACTGCC -3'
(R):5'- AGGACTGGTGATTTTTAAGCCAAG -3'
Posted On 2015-04-17