Mutagenetix > Incidental Mutations

Incidental Mutation 'R3941:Lrp1'

307457

Institutional Source

Beutler Lab

Gene Symbol

Lrp1

Ensembl Gene

ENSMUSG00000040249

Gene Name

low density lipoprotein receptor-related protein 1

Synonyms

A2mr, b2b1554Clo, CD91

MMRRC Submission

040923-MU

Accession Numbers

NCBI RefSeq: NM_008512.2; MGI:96828

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3941 (G1)

Quality Score

198

Status

Validated

Chromosome

Chromosomal Location

127538161-127621148 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 127553396 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 3217 (A3217V)

Ref Sequence

ENSEMBL: ENSMUSP00000044004 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049149] [ENSMUST00000129727]

Predicted Effect

probably damaging
Transcript: ENSMUST00000049149
AA Change: A3217V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000044004
Gene: ENSMUSG00000040249
AA Change: A3217V

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
LDLa	27	67	1.03e-15	SMART
LDLa	72	111	1.04e-11	SMART
EGF	115	150	8.78e-2	SMART
EGF_CA	151	190	4.49e-8	SMART
low complexity region	222	232	N/A	INTRINSIC
LY	273	315	7.07e-6	SMART
LY	316	359	2.31e-10	SMART
LY	360	402	8.3e-12	SMART
EGF	478	521	9.93e-1	SMART
LY	552	594	8.84e-7	SMART
LY	595	638	6.54e-10	SMART
LY	641	690	2.5e-15	SMART
LY	691	734	1.06e-9	SMART
EGF	807	844	1.38e1	SMART
LDLa	854	893	3.39e-16	SMART
LDLa	895	934	1.73e-13	SMART
LDLa	936	974	4.47e-16	SMART
LDLa	976	1014	2.53e-15	SMART
LDLa	1015	1054	2.95e-16	SMART
LDLa	1062	1100	3.24e-13	SMART
LDLa	1104	1143	2.97e-12	SMART
LDLa	1145	1185	1.24e-9	SMART
EGF	1185	1223	4.97e-1	SMART
EGF	1227	1263	6.02e0	SMART
LY	1290	1332	3.76e-1	SMART
LY	1337	1379	8.56e-14	SMART
LY	1380	1424	8.43e-13	SMART
LY	1425	1469	3.05e-10	SMART
LY	1471	1513	3.88e-3	SMART
EGF	1540	1580	1.85e0	SMART
LY	1606	1650	2.83e-5	SMART
LY	1651	1695	2.01e-10	SMART
LY	1698	1735	1.87e-5	SMART
LY	1736	1777	3.54e-6	SMART
LY	1778	1820	4.17e1	SMART
EGF	1850	1888	1.24e-1	SMART
LY	1915	1957	3.2e-4	SMART
LY	1958	2000	2.33e-15	SMART
LY	2001	2044	7.45e-14	SMART
LY	2045	2087	3.87e-12	SMART
LY	2089	2131	1.37e0	SMART
EGF	2159	2196	1.66e1	SMART
LY	2276	2318	5.57e-4	SMART
LY	2324	2369	3.3e-6	SMART
LY	2370	2412	3.93e-13	SMART
LY	2413	2454	3.62e-3	SMART
EGF_like	2482	2519	3.16e1	SMART
LDLa	2524	2564	3.31e-10	SMART
LDLa	2566	2603	7.21e-11	SMART
LDLa	2605	2642	1.09e-10	SMART
LDLa	2660	2691	6.05e-4	SMART
LDLa	2696	2733	2.49e-14	SMART
LDLa	2734	2772	4.65e-14	SMART
LDLa	2774	2815	3.92e-12	SMART
LDLa	2818	2856	1.51e-13	SMART
LDLa	2858	2900	1.93e-11	SMART
LDLa	2904	2942	1.73e-13	SMART
EGF_CA	2941	2982	6.16e-6	SMART
EGF_CA	2983	3023	2.66e-10	SMART
LY	3050	3094	6.64e-11	SMART
LY	3095	3137	7.17e-16	SMART
LY	3138	3181	4.28e-14	SMART
LY	3182	3224	8.11e-15	SMART
LY	3225	3265	1.44e-6	SMART
EGF	3294	3332	1.02e-2	SMART
LDLa	3334	3372	2.25e-12	SMART
LDLa	3374	3411	9.81e-13	SMART
LDLa	3413	3451	9.81e-13	SMART
LDLa	3453	3492	5.67e-18	SMART
LDLa	3494	3534	7.15e-15	SMART
LDLa	3536	3573	1.79e-15	SMART
EGF_like	3575	3611	4.83e1	SMART
LDLa	3575	3612	1.92e-15	SMART
LDLa	3613	3650	1.18e-15	SMART
LDLa	3654	3693	7.55e-14	SMART
LDLa	3695	3734	1.14e-8	SMART
LDLa	3741	3779	6.28e-11	SMART
EGF	3785	3824	1.06e1	SMART
EGF	3828	3862	1.51e0	SMART
LY	3893	3935	9.43e0	SMART
LY	3951	3993	1.23e-14	SMART
LY	3994	4037	2.98e-13	SMART
LY	4038	4080	4.28e-14	SMART
EGF	4151	4184	3.76e-1	SMART
low complexity region	4185	4198	N/A	INTRINSIC
EGF	4200	4233	3.82e-2	SMART
EGF	4236	4269	4.03e-1	SMART
EGF	4272	4305	5.2e-4	SMART
EGF	4308	4341	1.22e0	SMART
EGF_like	4344	4376	4.11e1	SMART
EGF	4377	4410	5.12e-3	SMART
transmembrane domain	4423	4445	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129727

Meta Mutation Damage Score

0.1168

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

98% (55/56)

MGI Phenotype

Strain: 2178192
Lethality: E10-E13
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low-density lipoprotein receptor family of proteins. The encoded preproprotein is proteolytically processed by furin to generate 515 kDa and 85 kDa subunits that form the mature receptor (PMID: 8546712). This receptor is involved in several cellular processes, including intracellular signaling, lipid homeostasis, and clearance of apoptotic cells. In addition, the encoded protein is necessary for the alpha 2-macroglobulin-mediated clearance of secreted amyloid precursor protein and beta-amyloid, the main component of amyloid plaques found in Alzheimer patients. Expression of this gene decreases with age and has been found to be lower than controls in brain tissue from Alzheimer's disease patients. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit lethality during late organogenesis. [provided by MGI curators]

Allele List at MGI

All alleles(42) : Targeted(9) Gene trapped(33)

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610203C20Rik	T	C	9: 41,590,274	L143P	probably damaging	Het
Abcc1	A	T	16: 14,396,399	T193S	probably benign	Het
Arhgap11a	A	T	2: 113,836,897	L435Q	probably damaging	Het
Bin1	T	C	18: 32,406,158	V48A	probably damaging	Het
Brinp3	C	A	1: 146,751,861	D277E	probably damaging	Het
Btn1a1	T	G	13: 23,459,264	R338S	probably benign	Het
Cacnb4	C	A	2: 52,469,489	R169L	probably damaging	Het
Ccdc80	A	G	16: 45,096,092	T404A	probably benign	Het
Cd2ap	G	C	17: 42,808,799	H488D	probably damaging	Het
Cdon	A	G	9: 35,464,171	T498A	probably benign	Het
Cngb3	A	G	4: 19,396,786	N380D	probably benign	Het
Col6a5	G	A	9: 105,939,834	S426F	unknown	Het
Cr2	A	T	1: 195,165,814	H345Q	probably damaging	Het
Cttnbp2	T	A	6: 18,427,453	K743M	probably benign	Het
Depdc1b	T	C	13: 108,368,836	S245P	probably damaging	Het
Dync2h1	G	A	9: 7,124,825	H2016Y	probably benign	Het
Eif2s3y	G	T	Y: 1,012,079	R98L	probably benign	Het
Eml6	C	T	11: 29,803,167	G915S	probably damaging	Het
Fcgr1	A	G	3: 96,286,033	L216P	probably benign	Het
Fpr-rs3	T	C	17: 20,624,849	N10S	probably benign	Het
Frem3	T	C	8: 80,615,020	I1314T	possibly damaging	Het
Gabrr3	A	G	16: 59,433,501	N194D	probably damaging	Het
Hey1	A	G	3: 8,664,578	L273P	probably damaging	Het
Irf6	A	G	1: 193,168,549	K365E	probably benign	Het
Kit	A	G	5: 75,609,318	D130G	probably benign	Het
Mei4	C	T	9: 81,927,283	R140C	probably benign	Het
Mpo	A	T	11: 87,797,349	K278M	probably benign	Het
Mprip	T	C	11: 59,731,502		probably benign	Het
Mug2	G	C	6: 122,063,563	G691R	probably benign	Het
Neto2	G	A	8: 85,674,118	T16I	probably damaging	Het
Nipal4	C	T	11: 46,150,646	V241M	probably damaging	Het
Nlrp2	A	T	7: 5,327,552	L615*	probably null	Het
Pcdh1	A	G	18: 38,199,458	V164A	probably benign	Het
Phc2	T	C	4: 128,747,244		probably null	Het
Plekhg3	A	G	12: 76,573,359	E623G	probably damaging	Het
Psors1c2	G	T	17: 35,533,928	G29*	probably null	Het
Slc25a54	A	T	3: 109,112,163	D361V	probably damaging	Het
Slc39a12	A	T	2: 14,396,181	H123L	possibly damaging	Het
Sorl1	T	C	9: 41,989,468		probably null	Het
Strn	A	T	17: 78,657,940	I641N	probably damaging	Het
Tapbp	A	G	17: 33,920,483	E151G	possibly damaging	Het
Ticrr	T	C	7: 79,693,697		probably benign	Het
Tnfrsf21	G	A	17: 43,038,010	C171Y	probably damaging	Het
Ttyh1	T	A	7: 4,129,318	L155H	probably damaging	Het
Utrn	T	A	10: 12,711,585		probably null	Het
Vmn1r175	A	G	7: 23,808,968	V78A	probably benign	Het
Vmn1r73	T	C	7: 11,756,755	Y167H	probably damaging	Het
Washc1	T	C	17: 66,118,128	S376P	probably damaging	Het
Wnt10a	T	A	1: 74,803,497		probably null	Het
Xrcc4	A	G	13: 90,071,633	V16A	probably benign	Het
Zeb1	T	C	18: 5,767,799	V770A	probably benign	Het
Zfp410	A	G	12: 84,338,753	N90S	probably damaging	Het

Other mutations in Lrp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00793:Lrp1	APN	10	127542205	missense	possibly damaging	0.89
IGL01065:Lrp1	APN	10	127575038	missense	probably benign	0.10
IGL01121:Lrp1	APN	10	127583853	nonsense	probably null
IGL01360:Lrp1	APN	10	127545820	missense	possibly damaging	0.93
IGL01402:Lrp1	APN	10	127595032	missense	probably damaging	1.00
IGL01404:Lrp1	APN	10	127595032	missense	probably damaging	1.00
IGL01411:Lrp1	APN	10	127581765	nonsense	probably null
IGL01469:Lrp1	APN	10	127584414	missense	probably damaging	1.00
IGL01552:Lrp1	APN	10	127588510	nonsense	probably null
IGL01682:Lrp1	APN	10	127574978	missense	probably benign	0.00
IGL01760:Lrp1	APN	10	127573501	missense	probably benign	0.00
IGL01918:Lrp1	APN	10	127554589	missense	probably damaging	0.99
IGL01989:Lrp1	APN	10	127578129	missense	probably damaging	1.00
IGL02105:Lrp1	APN	10	127544579	missense	probably damaging	1.00
IGL02158:Lrp1	APN	10	127554271	missense	probably benign	0.02
IGL02164:Lrp1	APN	10	127563667	missense	probably benign	0.39
IGL02337:Lrp1	APN	10	127576887	missense	possibly damaging	0.87
IGL02425:Lrp1	APN	10	127571887	critical splice donor site	probably null
IGL02493:Lrp1	APN	10	127581778	missense	probably damaging	0.99
IGL02563:Lrp1	APN	10	127551686	missense	probably damaging	1.00
IGL02590:Lrp1	APN	10	127552791	missense	probably damaging	1.00
IGL02624:Lrp1	APN	10	127572422	missense	probably damaging	0.98
IGL02625:Lrp1	APN	10	127574486	missense	probably damaging	1.00
IGL02825:Lrp1	APN	10	127542605	missense	probably damaging	1.00
IGL02880:Lrp1	APN	10	127540222	missense	probably benign	0.12
IGL02900:Lrp1	APN	10	127576647	splice site	probably benign
IGL02956:Lrp1	APN	10	127544559	missense	probably benign	0.00
IGL02974:Lrp1	APN	10	127555016	missense	probably damaging	0.99
IGL02983:Lrp1	APN	10	127550199	missense	probably damaging	1.00
IGL03002:Lrp1	APN	10	127589636	missense	probably damaging	1.00
IGL03091:Lrp1	APN	10	127559124	missense	probably benign	0.30
IGL03109:Lrp1	APN	10	127566645	missense	probably benign
IGL03194:Lrp1	APN	10	127568685	missense	probably damaging	1.00
IGL03232:Lrp1	APN	10	127539376	missense	probably damaging	1.00
extremis	UTSW	10	127556988	missense	probably benign	0.00
Jockey	UTSW	10	127560136	missense	probably damaging	1.00
peripheral	UTSW	10	127610381	missense	probably damaging	1.00
tangential	UTSW	10	127593848	missense	probably damaging	0.99
P0015:Lrp1	UTSW	10	127566663	missense	probably damaging	0.99
PIT4519001:Lrp1	UTSW	10	127607974	missense	possibly damaging	0.91
PIT4520001:Lrp1	UTSW	10	127607974	missense	possibly damaging	0.91
R0004:Lrp1	UTSW	10	127541825	splice site	probably null
R0034:Lrp1	UTSW	10	127545651	missense	probably benign	0.42
R0091:Lrp1	UTSW	10	127540979	missense	probably damaging	1.00
R0098:Lrp1	UTSW	10	127552738	missense	probably benign
R0098:Lrp1	UTSW	10	127552738	missense	probably benign
R0143:Lrp1	UTSW	10	127593942	missense	probably damaging	1.00
R0372:Lrp1	UTSW	10	127592136	missense	probably damaging	1.00
R0379:Lrp1	UTSW	10	127594969	missense	probably damaging	1.00
R0445:Lrp1	UTSW	10	127590636	nonsense	probably null
R0529:Lrp1	UTSW	10	127541594	splice site	probably null
R0551:Lrp1	UTSW	10	127571958	missense	probably benign
R0570:Lrp1	UTSW	10	127555009	nonsense	probably null
R0600:Lrp1	UTSW	10	127567383	missense	probably benign	0.00
R0626:Lrp1	UTSW	10	127567364	missense	probably damaging	1.00
R0647:Lrp1	UTSW	10	127571477	missense	probably damaging	1.00
R0680:Lrp1	UTSW	10	127589661	missense	probably damaging	1.00
R0792:Lrp1	UTSW	10	127567364	missense	probably damaging	1.00
R0792:Lrp1	UTSW	10	127575286	missense	probably benign	0.04
R0848:Lrp1	UTSW	10	127553362	splice site	probably null
R0866:Lrp1	UTSW	10	127539278	missense	probably damaging	1.00
R0918:Lrp1	UTSW	10	127593965	missense	probably damaging	1.00
R1076:Lrp1	UTSW	10	127563797	splice site	probably benign
R1107:Lrp1	UTSW	10	127557435	missense	probably damaging	1.00
R1346:Lrp1	UTSW	10	127605866	missense	probably damaging	1.00
R1403:Lrp1	UTSW	10	127581891	critical splice acceptor site	probably null
R1403:Lrp1	UTSW	10	127581891	critical splice acceptor site	probably null
R1496:Lrp1	UTSW	10	127539011	missense	probably damaging	1.00
R1522:Lrp1	UTSW	10	127567364	missense	probably damaging	1.00
R1522:Lrp1	UTSW	10	127575286	missense	probably benign	0.04
R1525:Lrp1	UTSW	10	127539529	missense	probably damaging	1.00
R1539:Lrp1	UTSW	10	127584381	splice site	probably null
R1589:Lrp1	UTSW	10	127605606	missense	probably benign	0.00
R1591:Lrp1	UTSW	10	127605606	missense	probably benign	0.00
R1663:Lrp1	UTSW	10	127556921	missense	probably damaging	1.00
R1682:Lrp1	UTSW	10	127574332	missense	probably damaging	1.00
R1717:Lrp1	UTSW	10	127556269	missense	possibly damaging	0.59
R1717:Lrp1	UTSW	10	127563665	missense	probably damaging	1.00
R1758:Lrp1	UTSW	10	127588584	missense	possibly damaging	0.76
R1826:Lrp1	UTSW	10	127553707	missense	probably damaging	1.00
R1842:Lrp1	UTSW	10	127573468	missense	possibly damaging	0.93
R1844:Lrp1	UTSW	10	127595283	critical splice donor site	probably null
R1845:Lrp1	UTSW	10	127578673	missense	probably damaging	1.00
R1896:Lrp1	UTSW	10	127559998	missense	possibly damaging	0.64
R1952:Lrp1	UTSW	10	127567431	missense	probably damaging	1.00
R2009:Lrp1	UTSW	10	127544516	missense	probably damaging	1.00
R2015:Lrp1	UTSW	10	127540694	missense	probably benign	0.00
R2116:Lrp1	UTSW	10	127576493	nonsense	probably null
R2161:Lrp1	UTSW	10	127555738	missense	probably damaging	1.00
R2199:Lrp1	UTSW	10	127546840	missense	probably damaging	1.00
R2213:Lrp1	UTSW	10	127540702	missense	probably damaging	1.00
R2300:Lrp1	UTSW	10	127556915	nonsense	probably null
R2324:Lrp1	UTSW	10	127566586	missense	possibly damaging	0.92
R2849:Lrp1	UTSW	10	127542296	missense	probably damaging	1.00
R2926:Lrp1	UTSW	10	127588113	missense	probably damaging	0.98
R2993:Lrp1	UTSW	10	127610381	missense	probably damaging	1.00
R3522:Lrp1	UTSW	10	127553555	missense	probably damaging	1.00
R3702:Lrp1	UTSW	10	127595103	missense	probably damaging	1.00
R3789:Lrp1	UTSW	10	127571969	missense	possibly damaging	0.94
R3898:Lrp1	UTSW	10	127592100	nonsense	probably null
R3958:Lrp1	UTSW	10	127571958	missense	probably benign
R4369:Lrp1	UTSW	10	127550286	missense	possibly damaging	0.87
R4510:Lrp1	UTSW	10	127593848	missense	probably damaging	0.99
R4511:Lrp1	UTSW	10	127593848	missense	probably damaging	0.99
R4576:Lrp1	UTSW	10	127540188	small deletion	probably benign
R4583:Lrp1	UTSW	10	127541372	missense	probably benign	0.00
R4662:Lrp1	UTSW	10	127552185	nonsense	probably null
R4721:Lrp1	UTSW	10	127555059	missense	possibly damaging	0.58
R4728:Lrp1	UTSW	10	127563737	missense	probably damaging	1.00
R4745:Lrp1	UTSW	10	127549944	missense	probably benign	0.20
R4785:Lrp1	UTSW	10	127558133	missense	probably benign	0.12
R4841:Lrp1	UTSW	10	127583936	missense	probably damaging	1.00
R4842:Lrp1	UTSW	10	127583936	missense	probably damaging	1.00
R4855:Lrp1	UTSW	10	127610442	missense	probably benign	0.03
R4860:Lrp1	UTSW	10	127553824	missense	probably damaging	1.00
R4860:Lrp1	UTSW	10	127553824	missense	probably damaging	1.00
R4891:Lrp1	UTSW	10	127541752	missense	probably damaging	1.00
R4925:Lrp1	UTSW	10	127575075	nonsense	probably null
R4970:Lrp1	UTSW	10	127539520	missense	probably benign	0.11
R4999:Lrp1	UTSW	10	127553779	missense	probably damaging	1.00
R5044:Lrp1	UTSW	10	127567495	missense	probably damaging	1.00
R5127:Lrp1	UTSW	10	127539634	intron	probably benign
R5188:Lrp1	UTSW	10	127607952	missense	probably damaging	1.00
R5218:Lrp1	UTSW	10	127548619	missense	probably damaging	1.00
R5225:Lrp1	UTSW	10	127556096	missense	probably benign	0.04
R5291:Lrp1	UTSW	10	127593878	missense	probably damaging	1.00
R5386:Lrp1	UTSW	10	127592114	missense	probably damaging	1.00
R5395:Lrp1	UTSW	10	127595297	missense	probably damaging	1.00
R5413:Lrp1	UTSW	10	127588067	critical splice donor site	probably null
R5430:Lrp1	UTSW	10	127541061	missense	probably damaging	0.99
R5499:Lrp1	UTSW	10	127572944	missense	possibly damaging	0.58
R5526:Lrp1	UTSW	10	127555724	missense	probably benign	0.37
R5580:Lrp1	UTSW	10	127588520	missense	probably benign
R5583:Lrp1	UTSW	10	127588463	missense	probably benign	0.08
R5599:Lrp1	UTSW	10	127593869	missense	probably damaging	1.00
R5639:Lrp1	UTSW	10	127593839	missense	probably damaging	0.99
R5677:Lrp1	UTSW	10	127574429	missense	probably damaging	1.00
R5730:Lrp1	UTSW	10	127583834	missense	probably benign	0.00
R5742:Lrp1	UTSW	10	127548347	missense	probably damaging	0.98
R5764:Lrp1	UTSW	10	127595318	missense	probably benign	0.41
R5864:Lrp1	UTSW	10	127567505	missense	possibly damaging	0.58
R5937:Lrp1	UTSW	10	127583876	missense	possibly damaging	0.93
R5947:Lrp1	UTSW	10	127589554	critical splice donor site	probably null
R5976:Lrp1	UTSW	10	127583901	missense	probably damaging	1.00
R6021:Lrp1	UTSW	10	127578014	missense	probably damaging	1.00
R6026:Lrp1	UTSW	10	127573403	missense	probably damaging	1.00
R6045:Lrp1	UTSW	10	127566600	missense	probably damaging	0.98
R6057:Lrp1	UTSW	10	127567490	missense	probably damaging	1.00
R6084:Lrp1	UTSW	10	127560553	missense	probably benign	0.09
R6131:Lrp1	UTSW	10	127560157	missense	probably benign
R6235:Lrp1	UTSW	10	127588177	missense	probably damaging	1.00
R6280:Lrp1	UTSW	10	127589584	missense	probably benign	0.04
R6307:Lrp1	UTSW	10	127592075	missense	probably damaging	1.00
R6532:Lrp1	UTSW	10	127541682	missense	probably damaging	1.00
R6532:Lrp1	UTSW	10	127549407	missense	probably damaging	1.00
R6536:Lrp1	UTSW	10	127558068	splice site	probably null
R6605:Lrp1	UTSW	10	127560136	missense	probably damaging	1.00
R6607:Lrp1	UTSW	10	127560136	missense	probably damaging	1.00
R6631:Lrp1	UTSW	10	127574332	missense	probably damaging	1.00
R6676:Lrp1	UTSW	10	127560136	missense	probably damaging	1.00
R6678:Lrp1	UTSW	10	127560136	missense	probably damaging	1.00
R6809:Lrp1	UTSW	10	127555056	missense	probably benign	0.04
R6884:Lrp1	UTSW	10	127559117	missense	probably benign	0.00
R6925:Lrp1	UTSW	10	127556988	missense	probably benign	0.00
R6987:Lrp1	UTSW	10	127575005	missense	probably damaging	1.00
R7016:Lrp1	UTSW	10	127559967	critical splice donor site	probably null
R7030:Lrp1	UTSW	10	127552876	missense	probably damaging	0.97
R7053:Lrp1	UTSW	10	127541094	missense	probably damaging	1.00
R7076:Lrp1	UTSW	10	127550183	critical splice donor site	probably null
R7136:Lrp1	UTSW	10	127558622	missense	probably damaging	1.00
R7180:Lrp1	UTSW	10	127556965	missense	probably damaging	1.00
R7199:Lrp1	UTSW	10	127573456	missense	probably damaging	0.99
R7219:Lrp1	UTSW	10	127557228	missense	probably benign	0.40
R7233:Lrp1	UTSW	10	127595061	missense	probably damaging	1.00
R7251:Lrp1	UTSW	10	127572554	missense	probably damaging	1.00
R7264:Lrp1	UTSW	10	127592093	missense	probably damaging	1.00
R7302:Lrp1	UTSW	10	127538987	missense	probably benign	0.01
R7313:Lrp1	UTSW	10	127553468	missense	probably damaging	1.00
R7322:Lrp1	UTSW	10	127545564	missense	probably benign	0.24
R7354:Lrp1	UTSW	10	127571408	missense	probably damaging	1.00
R7375:Lrp1	UTSW	10	127539348	missense	probably damaging	1.00
R7388:Lrp1	UTSW	10	127583897	nonsense	probably null
R7404:Lrp1	UTSW	10	127582708	missense
R7405:Lrp1	UTSW	10	127581751	missense	possibly damaging	0.93
R7477:Lrp1	UTSW	10	127568920	missense	probably damaging	1.00
R7555:Lrp1	UTSW	10	127546862	missense	probably damaging	1.00
R7600:Lrp1	UTSW	10	127555706	missense	probably benign
R7678:Lrp1	UTSW	10	127574053	missense	probably damaging	1.00
R7679:Lrp1	UTSW	10	127588428	nonsense	probably null
R7951:Lrp1	UTSW	10	127539064	nonsense	probably null
R7964:Lrp1	UTSW	10	127575044	missense	possibly damaging	0.94
R8006:Lrp1	UTSW	10	127589619	missense	probably damaging	1.00
R8021:Lrp1	UTSW	10	127548346	missense	possibly damaging	0.92
R8098:Lrp1	UTSW	10	127574455	missense	possibly damaging	0.78
R8112:Lrp1	UTSW	10	127605846	missense	probably damaging	1.00
R8210:Lrp1	UTSW	10	127576485	missense	probably damaging	1.00
R8249:Lrp1	UTSW	10	127605543	missense	probably benign
R8291:Lrp1	UTSW	10	127589703	missense	probably damaging	1.00
R8332:Lrp1	UTSW	10	127571936	missense	probably damaging	1.00
R8435:Lrp1	UTSW	10	127556330	missense	probably damaging	0.97
R8467:Lrp1	UTSW	10	127558650	missense	probably damaging	1.00
R8468:Lrp1	UTSW	10	127558650	missense	probably damaging	1.00
R8474:Lrp1	UTSW	10	127539703	missense	probably damaging	1.00
R8481:Lrp1	UTSW	10	127568910	missense	probably damaging	1.00
R8483:Lrp1	UTSW	10	127558650	missense	probably damaging	1.00
R8485:Lrp1	UTSW	10	127558650	missense	probably damaging	1.00
R8488:Lrp1	UTSW	10	127560487	missense	probably damaging	1.00
V3553:Lrp1	UTSW	10	127571442	missense	probably damaging	1.00
Y5406:Lrp1	UTSW	10	127554283	missense	probably damaging	1.00
Z1088:Lrp1	UTSW	10	127584379	missense	probably damaging	1.00
Z1176:Lrp1	UTSW	10	127554962	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTAAGGAGCTGGATTGAGGCC -3'
(R):5'- TAGGATTCACTGCTCCCCAC -3'

Sequencing Primer
(F):5'- TGGAGTCTGGGCCCATC -3'
(R):5'- TGCCAGGTACCTGTACTGGAC -3'

Posted On

2015-04-17