Incidental Mutation 'R0376:Zc3hc1'
ID30746
Institutional Source Beutler Lab
Gene Symbol Zc3hc1
Ensembl Gene ENSMUSG00000039130
Gene Namezinc finger, C3HC type 1
Synonyms1110054L24Rik, Nipa, HSPC216
MMRRC Submission 038582-MU
Accession Numbers

Genbank: NM_172735; MGI: 1916023

Is this an essential gene? Possibly essential (E-score: 0.614) question?
Stock #R0376 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location30366380-30391028 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 30372790 bp
ZygosityHeterozygous
Amino Acid Change Serine to Tryptophan at position 351 (S351W)
Ref Sequence ENSEMBL: ENSMUSP00000135447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080812] [ENSMUST00000102992] [ENSMUST00000115184] [ENSMUST00000136255] [ENSMUST00000152391]
Predicted Effect probably damaging
Transcript: ENSMUST00000080812
AA Change: S393W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079627
Gene: ENSMUSG00000039130
AA Change: S393W

DomainStartEndE-ValueType
Pfam:zf-C3HC 72 201 2e-38 PFAM
low complexity region 216 231 N/A INTRINSIC
Pfam:Rsm1 248 343 6.8e-14 PFAM
low complexity region 406 420 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102992
AA Change: S393W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100057
Gene: ENSMUSG00000039130
AA Change: S393W

DomainStartEndE-ValueType
Pfam:zf-C3HC 72 201 2.4e-37 PFAM
low complexity region 216 231 N/A INTRINSIC
Pfam:Rsm1 248 343 2.2e-13 PFAM
low complexity region 406 420 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115184
SMART Domains Protein: ENSMUSP00000110838
Gene: ENSMUSG00000039130

DomainStartEndE-ValueType
Pfam:zf-C3HC 72 201 5.9e-38 PFAM
low complexity region 216 231 N/A INTRINSIC
Pfam:Rsm1 248 339 8.6e-14 PFAM
Pfam:Rsm1 331 394 4.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126945
Predicted Effect probably benign
Transcript: ENSMUST00000136255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138983
Predicted Effect probably benign
Transcript: ENSMUST00000147990
Predicted Effect probably damaging
Transcript: ENSMUST00000152391
AA Change: S351W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135447
Gene: ENSMUSG00000039130
AA Change: S351W

DomainStartEndE-ValueType
Pfam:zf-C3HC 72 201 9e-38 PFAM
low complexity region 216 231 N/A INTRINSIC
low complexity region 364 378 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.0%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an F-box-containing protein that is a component of an SCF-type E3 ubiquitin ligase complex that regulates the onset of cell division. The G2/M transition in the cell cycle requires the interaction of the proteins cyclin B1 and cyclin-dependent kinase 1. The activated ubiquitin ligase complex targets the protein cyclin B1 for degradation, preventing this transition to mitosis. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a null mutation display partial lethality with male infertility, reduced female fertility, arrest of meiosis, impaired synaptonemal complex formation and delayed double strand DNA break repair. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, other(2) Gene trapped(10)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik G A 2: 173,528,327 E132K probably benign Het
Adam6a T C 12: 113,544,690 Y228H probably damaging Het
Als2 A G 1: 59,215,565 F211S probably benign Het
Ankrd12 T A 17: 66,053,009 Q11L probably damaging Het
Anxa5 T C 3: 36,460,488 R115G probably damaging Het
Arhgap10 T C 8: 77,450,824 probably benign Het
Atp2a3 T A 11: 72,982,702 D782E probably damaging Het
Bcr G T 10: 75,145,327 L659F probably damaging Het
Cacna1b A G 2: 24,659,003 probably benign Het
Camp C T 9: 109,848,399 C122Y probably damaging Het
Col12a1 A T 9: 79,693,494 S769R probably benign Het
Cyp2j6 T A 4: 96,526,023 K335I probably damaging Het
Cyp3a11 A C 5: 145,862,452 Y308* probably null Het
Flnb G A 14: 7,946,014 probably null Het
Frmd4a G T 2: 4,572,387 M351I probably damaging Het
Gabrg2 C T 11: 41,916,315 S365N possibly damaging Het
Ggn T C 7: 29,173,022 V609A possibly damaging Het
H60c T C 10: 3,260,435 probably benign Het
Hexdc T A 11: 121,218,165 probably benign Het
Igsf9b A G 9: 27,334,582 T1282A probably benign Het
Ikzf4 T C 10: 128,632,756 N618S probably benign Het
Ints14 A G 9: 64,983,990 K418E probably damaging Het
Iqgap1 T C 7: 80,723,879 E1454G probably benign Het
Kif13b T C 14: 64,757,404 probably benign Het
Krt71 A C 15: 101,738,070 F328C probably damaging Het
Lama2 T C 10: 27,015,546 T2524A possibly damaging Het
Mfn2 C T 4: 147,885,526 V363I probably benign Het
Mkln1 A T 6: 31,478,018 D496V probably benign Het
Olfr450 A T 6: 42,818,292 M274L probably benign Het
Patj T A 4: 98,568,987 I1242N probably damaging Het
Pcnx C T 12: 81,974,579 probably benign Het
Plcb2 T C 2: 118,717,240 E502G probably damaging Het
Plppr4 G T 3: 117,323,091 H314Q probably benign Het
Prkcsh A G 9: 22,010,251 probably benign Het
Prr14 C T 7: 127,476,643 H181Y probably benign Het
Pus3 A T 9: 35,566,422 M317L possibly damaging Het
Pwwp2a T A 11: 43,704,672 D221E probably benign Het
Rbm15 T C 3: 107,330,938 S715G probably benign Het
Rbm28 A G 6: 29,158,928 probably benign Het
Rhobtb2 A T 14: 69,796,735 V347E probably benign Het
Rimbp2 C T 5: 128,803,861 R161Q probably damaging Het
Scgb1b27 C T 7: 34,021,897 T70I possibly damaging Het
Slc40a1 T C 1: 45,912,491 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spaca9 A G 2: 28,693,660 V104A probably benign Het
Spag7 T C 11: 70,669,190 probably benign Het
Sugp1 A G 8: 70,052,638 D85G probably damaging Het
Sun1 A G 5: 139,226,699 probably benign Het
Tcp11l1 C A 2: 104,697,505 probably benign Het
Tead3 A C 17: 28,341,365 D88E probably damaging Het
Tecpr1 A T 5: 144,207,476 V636E possibly damaging Het
Tldc2 T C 2: 157,095,305 W147R probably damaging Het
Tmem161b A G 13: 84,292,383 T125A probably benign Het
Trrap A G 5: 144,816,339 M1825V probably benign Het
Ttbk2 A G 2: 120,777,581 F186L probably damaging Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Zc3h7a T C 16: 11,156,202 M240V probably benign Het
Zfp366 T C 13: 99,234,251 M493T probably benign Het
Zfp93 C T 7: 24,275,861 P424S probably damaging Het
Other mutations in Zc3hc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01571:Zc3hc1 APN 6 30390863 missense probably benign 0.43
IGL01843:Zc3hc1 APN 6 30372730 splice site probably benign
IGL02358:Zc3hc1 APN 6 30376058 missense probably benign 0.04
IGL02379:Zc3hc1 APN 6 30390975 missense probably benign 0.38
IGL02567:Zc3hc1 APN 6 30374849 missense probably benign
F6893:Zc3hc1 UTSW 6 30387526 missense probably benign 0.07
R0532:Zc3hc1 UTSW 6 30374930 splice site probably benign
R1521:Zc3hc1 UTSW 6 30376025 missense probably benign 0.00
R1690:Zc3hc1 UTSW 6 30390941 missense probably damaging 0.96
R1861:Zc3hc1 UTSW 6 30374838 missense probably benign
R3085:Zc3hc1 UTSW 6 30374764 critical splice donor site probably null
R4619:Zc3hc1 UTSW 6 30387524 missense probably benign 0.27
R4721:Zc3hc1 UTSW 6 30374900 missense probably benign 0.03
R4847:Zc3hc1 UTSW 6 30375982 missense probably benign 0.18
R5000:Zc3hc1 UTSW 6 30375988 missense possibly damaging 0.67
R5870:Zc3hc1 UTSW 6 30382683 nonsense probably null
R7195:Zc3hc1 UTSW 6 30382548 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- GTTGGATCAGCCAACCATCTCTCC -3'
(R):5'- AGGAAGACTATCCTATCACGCTTCCC -3'

Sequencing Primer
(F):5'- ccacttgtgatcctgactcc -3'
(R):5'- TCACATGCTAGGAATACTCGG -3'
Posted On2013-04-24