Incidental Mutation 'R3941:Mpo'
ID307460
Institutional Source Beutler Lab
Gene Symbol Mpo
Ensembl Gene ENSMUSG00000009350
Gene Namemyeloperoxidase
Synonyms
MMRRC Submission 040923-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3941 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location87793581-87804413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87797349 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 278 (K278M)
Ref Sequence ENSEMBL: ENSMUSP00000112837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020779] [ENSMUST00000107930] [ENSMUST00000121303] [ENSMUST00000143021]
Predicted Effect probably benign
Transcript: ENSMUST00000020779
AA Change: K278M

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000020779
Gene: ENSMUSG00000009350
AA Change: K278M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:An_peroxidase 147 692 4.2e-183 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107930
SMART Domains Protein: ENSMUSP00000103563
Gene: ENSMUSG00000009350

DomainStartEndE-ValueType
SCOP:g1cxp.1 82 99 1e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121303
AA Change: K278M

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000112837
Gene: ENSMUSG00000009350
AA Change: K278M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:An_peroxidase 147 692 4.2e-183 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130442
Predicted Effect probably benign
Transcript: ENSMUST00000143021
SMART Domains Protein: ENSMUSP00000123371
Gene: ENSMUSG00000009350

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PDB:4C1M|B 139 167 4e-11 PDB
SCOP:g1cxp.1 141 167 4e-10 SMART
Meta Mutation Damage Score 0.1384 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myeloperoxidase (MPO) is a heme protein synthesized during myeloid differentiation that constitutes the major component of neutrophil azurophilic granules. Produced as a single chain precursor, myeloperoxidase is subsequently cleaved into a light and heavy chain. The mature myeloperoxidase is a tetramer composed of 2 light chains and 2 heavy chains. This enzyme produces hypohalous acids central to the microbicidal activity of neutrophils. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous inactivation of this gene causes neutrophil dysfunction and decreased resistance to fungal infection with Candida, and may lead to enhanced atherosclerosis, reduced neutrophil-mediated lysis of muscle cells, decreased resistance to EAE, and altered asbestos-induced lung inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610203C20Rik T C 9: 41,590,274 L143P probably damaging Het
Abcc1 A T 16: 14,396,399 T193S probably benign Het
Arhgap11a A T 2: 113,836,897 L435Q probably damaging Het
Bin1 T C 18: 32,406,158 V48A probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Btn1a1 T G 13: 23,459,264 R338S probably benign Het
Cacnb4 C A 2: 52,469,489 R169L probably damaging Het
Ccdc80 A G 16: 45,096,092 T404A probably benign Het
Cd2ap G C 17: 42,808,799 H488D probably damaging Het
Cdon A G 9: 35,464,171 T498A probably benign Het
Cngb3 A G 4: 19,396,786 N380D probably benign Het
Col6a5 G A 9: 105,939,834 S426F unknown Het
Cr2 A T 1: 195,165,814 H345Q probably damaging Het
Cttnbp2 T A 6: 18,427,453 K743M probably benign Het
Depdc1b T C 13: 108,368,836 S245P probably damaging Het
Dync2h1 G A 9: 7,124,825 H2016Y probably benign Het
Eif2s3y G T Y: 1,012,079 R98L probably benign Het
Eml6 C T 11: 29,803,167 G915S probably damaging Het
Fcgr1 A G 3: 96,286,033 L216P probably benign Het
Fpr-rs3 T C 17: 20,624,849 N10S probably benign Het
Frem3 T C 8: 80,615,020 I1314T possibly damaging Het
Gabrr3 A G 16: 59,433,501 N194D probably damaging Het
Hey1 A G 3: 8,664,578 L273P probably damaging Het
Irf6 A G 1: 193,168,549 K365E probably benign Het
Kit A G 5: 75,609,318 D130G probably benign Het
Lrp1 G A 10: 127,553,396 A3217V probably damaging Het
Mei4 C T 9: 81,927,283 R140C probably benign Het
Mprip T C 11: 59,731,502 probably benign Het
Mug2 G C 6: 122,063,563 G691R probably benign Het
Neto2 G A 8: 85,674,118 T16I probably damaging Het
Nipal4 C T 11: 46,150,646 V241M probably damaging Het
Nlrp2 A T 7: 5,327,552 L615* probably null Het
Pcdh1 A G 18: 38,199,458 V164A probably benign Het
Phc2 T C 4: 128,747,244 probably null Het
Plekhg3 A G 12: 76,573,359 E623G probably damaging Het
Psors1c2 G T 17: 35,533,928 G29* probably null Het
Slc25a54 A T 3: 109,112,163 D361V probably damaging Het
Slc39a12 A T 2: 14,396,181 H123L possibly damaging Het
Sorl1 T C 9: 41,989,468 probably null Het
Strn A T 17: 78,657,940 I641N probably damaging Het
Tapbp A G 17: 33,920,483 E151G possibly damaging Het
Ticrr T C 7: 79,693,697 probably benign Het
Tnfrsf21 G A 17: 43,038,010 C171Y probably damaging Het
Ttyh1 T A 7: 4,129,318 L155H probably damaging Het
Utrn T A 10: 12,711,585 probably null Het
Vmn1r175 A G 7: 23,808,968 V78A probably benign Het
Vmn1r73 T C 7: 11,756,755 Y167H probably damaging Het
Washc1 T C 17: 66,118,128 S376P probably damaging Het
Wnt10a T A 1: 74,803,497 probably null Het
Xrcc4 A G 13: 90,071,633 V16A probably benign Het
Zeb1 T C 18: 5,767,799 V770A probably benign Het
Zfp410 A G 12: 84,338,753 N90S probably damaging Het
Other mutations in Mpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Mpo APN 11 87802617 missense probably benign
IGL00668:Mpo APN 11 87797334 missense probably benign 0.01
IGL01016:Mpo APN 11 87797610 splice site probably null
IGL01517:Mpo APN 11 87795821 missense possibly damaging 0.83
IGL01530:Mpo APN 11 87801191 missense probably benign 0.00
IGL02123:Mpo APN 11 87794795 missense probably benign 0.05
BB001:Mpo UTSW 11 87794840 missense probably damaging 1.00
BB011:Mpo UTSW 11 87794840 missense probably damaging 1.00
R0091:Mpo UTSW 11 87801610 missense probably benign 0.06
R0458:Mpo UTSW 11 87796297 missense probably benign 0.35
R0506:Mpo UTSW 11 87803504 missense probably benign 0.00
R0574:Mpo UTSW 11 87796076 missense probably damaging 0.99
R0850:Mpo UTSW 11 87797502 missense probably damaging 1.00
R1488:Mpo UTSW 11 87797430 missense probably damaging 1.00
R1753:Mpo UTSW 11 87795881 missense probably benign 0.06
R1785:Mpo UTSW 11 87797361 missense possibly damaging 0.90
R1891:Mpo UTSW 11 87801280 nonsense probably null
R1989:Mpo UTSW 11 87803472 missense probably damaging 1.00
R2107:Mpo UTSW 11 87796075 missense probably damaging 1.00
R2108:Mpo UTSW 11 87796075 missense probably damaging 1.00
R2130:Mpo UTSW 11 87797361 missense possibly damaging 0.90
R2132:Mpo UTSW 11 87797361 missense possibly damaging 0.90
R3930:Mpo UTSW 11 87801040 missense probably damaging 1.00
R3931:Mpo UTSW 11 87801040 missense probably damaging 1.00
R4323:Mpo UTSW 11 87796039 missense probably damaging 1.00
R4857:Mpo UTSW 11 87796281 missense probably benign
R4892:Mpo UTSW 11 87802681 missense probably benign 0.00
R5224:Mpo UTSW 11 87796457 unclassified probably benign
R5250:Mpo UTSW 11 87803433 missense probably benign 0.03
R5373:Mpo UTSW 11 87803611 critical splice donor site probably null
R5374:Mpo UTSW 11 87803611 critical splice donor site probably null
R5408:Mpo UTSW 11 87801025 splice site probably null
R5708:Mpo UTSW 11 87801755 splice site probably null
R6354:Mpo UTSW 11 87797346 missense possibly damaging 0.89
R6598:Mpo UTSW 11 87799972 missense probably benign 0.43
R6713:Mpo UTSW 11 87795368 missense probably damaging 1.00
R7053:Mpo UTSW 11 87803510 missense probably damaging 0.99
R7395:Mpo UTSW 11 87801124 missense probably damaging 1.00
R7573:Mpo UTSW 11 87797577 missense probably benign 0.01
R7924:Mpo UTSW 11 87794840 missense probably damaging 1.00
R8152:Mpo UTSW 11 87801649 missense probably benign
R8285:Mpo UTSW 11 87797567 missense probably benign 0.05
R8776:Mpo UTSW 11 87802712 missense possibly damaging 0.50
R8776-TAIL:Mpo UTSW 11 87802712 missense possibly damaging 0.50
R8807:Mpo UTSW 11 87796339 missense probably benign 0.05
R8829:Mpo UTSW 11 87803424 missense probably damaging 1.00
RF018:Mpo UTSW 11 87797639 missense probably damaging 1.00
Z1088:Mpo UTSW 11 87795245 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGTTCAGTGAATTCTTTGTCACCC -3'
(R):5'- CGTGTATTGATAGCCAGCAGC -3'

Sequencing Primer
(F):5'- AAACCTCAGTCTCTTTGCTGACTGAG -3'
(R):5'- TATTGATAGCCAGCAGCCCCAG -3'
Posted On2015-04-17