Incidental Mutation 'R3941:Abcc1'
ID307468
Institutional Source Beutler Lab
Gene Symbol Abcc1
Ensembl Gene ENSMUSG00000023088
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 1
SynonymsMrp1, Mdrap, MRP, Abcc1b, Abcc1a
MMRRC Submission 040923-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R3941 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location14361558-14475737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14396399 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 193 (T193S)
Ref Sequence ENSEMBL: ENSMUSP00000115763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100167] [ENSMUST00000130671] [ENSMUST00000133454] [ENSMUST00000134776] [ENSMUST00000144676] [ENSMUST00000147759] [ENSMUST00000154748]
Predicted Effect probably benign
Transcript: ENSMUST00000100167
AA Change: T180S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097743
Gene: ENSMUSG00000023088
AA Change: T180S

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 7.8e-44 PFAM
AAA 670 845 4.07e-8 SMART
Pfam:ABC_membrane 971 1243 3e-52 PFAM
AAA 1316 1501 5.8e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130671
AA Change: T180S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116714
Gene: ENSMUSG00000023088
AA Change: T180S

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133454
AA Change: T180S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122656
Gene: ENSMUSG00000023088
AA Change: T180S

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134776
SMART Domains Protein: ENSMUSP00000120933
Gene: ENSMUSG00000023088

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 131 153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144074
Predicted Effect probably benign
Transcript: ENSMUST00000144676
SMART Domains Protein: ENSMUSP00000116726
Gene: ENSMUSG00000023088

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 63 80 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147759
AA Change: T180S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115627
Gene: ENSMUSG00000023088
AA Change: T180S

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154748
AA Change: T193S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000115763
Gene: ENSMUSG00000023088
AA Change: T193S

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
transmembrane domain 115 137 N/A INTRINSIC
transmembrane domain 144 166 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This full transporter is a member of the MRP subfamily which is involved in multi-drug resistance. This protein plays an essential role in the defense against toxic compounds and serves as the major high-affinity transporter of leukotriene C4. The encoded protein may also play an essential role in steroid hormone homeostasis as a transporter for steroid hormones and their metabolites. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene have a reduced response to inflammatory stimulus, increased levels of glutathione due to impaired metabolism, and are hypersensitive to the anticancer drug etoposide. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610203C20Rik T C 9: 41,590,274 L143P probably damaging Het
Arhgap11a A T 2: 113,836,897 L435Q probably damaging Het
Bin1 T C 18: 32,406,158 V48A probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Btn1a1 T G 13: 23,459,264 R338S probably benign Het
Cacnb4 C A 2: 52,469,489 R169L probably damaging Het
Ccdc80 A G 16: 45,096,092 T404A probably benign Het
Cd2ap G C 17: 42,808,799 H488D probably damaging Het
Cdon A G 9: 35,464,171 T498A probably benign Het
Cngb3 A G 4: 19,396,786 N380D probably benign Het
Col6a5 G A 9: 105,939,834 S426F unknown Het
Cr2 A T 1: 195,165,814 H345Q probably damaging Het
Cttnbp2 T A 6: 18,427,453 K743M probably benign Het
Depdc1b T C 13: 108,368,836 S245P probably damaging Het
Dync2h1 G A 9: 7,124,825 H2016Y probably benign Het
Eif2s3y G T Y: 1,012,079 R98L probably benign Het
Eml6 C T 11: 29,803,167 G915S probably damaging Het
Fcgr1 A G 3: 96,286,033 L216P probably benign Het
Fpr-rs3 T C 17: 20,624,849 N10S probably benign Het
Frem3 T C 8: 80,615,020 I1314T possibly damaging Het
Gabrr3 A G 16: 59,433,501 N194D probably damaging Het
Hey1 A G 3: 8,664,578 L273P probably damaging Het
Irf6 A G 1: 193,168,549 K365E probably benign Het
Kit A G 5: 75,609,318 D130G probably benign Het
Lrp1 G A 10: 127,553,396 A3217V probably damaging Het
Mei4 C T 9: 81,927,283 R140C probably benign Het
Mpo A T 11: 87,797,349 K278M probably benign Het
Mprip T C 11: 59,731,502 probably benign Het
Mug2 G C 6: 122,063,563 G691R probably benign Het
Neto2 G A 8: 85,674,118 T16I probably damaging Het
Nipal4 C T 11: 46,150,646 V241M probably damaging Het
Nlrp2 A T 7: 5,327,552 L615* probably null Het
Pcdh1 A G 18: 38,199,458 V164A probably benign Het
Phc2 T C 4: 128,747,244 probably null Het
Plekhg3 A G 12: 76,573,359 E623G probably damaging Het
Psors1c2 G T 17: 35,533,928 G29* probably null Het
Slc25a54 A T 3: 109,112,163 D361V probably damaging Het
Slc39a12 A T 2: 14,396,181 H123L possibly damaging Het
Sorl1 T C 9: 41,989,468 probably null Het
Strn A T 17: 78,657,940 I641N probably damaging Het
Tapbp A G 17: 33,920,483 E151G possibly damaging Het
Ticrr T C 7: 79,693,697 probably benign Het
Tnfrsf21 G A 17: 43,038,010 C171Y probably damaging Het
Ttyh1 T A 7: 4,129,318 L155H probably damaging Het
Utrn T A 10: 12,711,585 probably null Het
Vmn1r175 A G 7: 23,808,968 V78A probably benign Het
Vmn1r73 T C 7: 11,756,755 Y167H probably damaging Het
Washc1 T C 17: 66,118,128 S376P probably damaging Het
Wnt10a T A 1: 74,803,497 probably null Het
Xrcc4 A G 13: 90,071,633 V16A probably benign Het
Zeb1 T C 18: 5,767,799 V770A probably benign Het
Zfp410 A G 12: 84,338,753 N90S probably damaging Het
Other mutations in Abcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abcc1 APN 16 14460983 missense probably benign 0.34
IGL00094:Abcc1 APN 16 14470534 missense probably null 0.00
IGL00475:Abcc1 APN 16 14436573 missense probably damaging 1.00
IGL00516:Abcc1 APN 16 14413312 nonsense probably null
IGL00765:Abcc1 APN 16 14411508 missense probably damaging 0.99
IGL00792:Abcc1 APN 16 14410926 missense probably benign 0.18
IGL01678:Abcc1 APN 16 14405019 missense probably null 0.96
IGL01683:Abcc1 APN 16 14396424 missense probably damaging 1.00
IGL01955:Abcc1 APN 16 14410795 missense probably damaging 1.00
IGL02048:Abcc1 APN 16 14411519 missense probably damaging 0.98
IGL02345:Abcc1 APN 16 14396351 missense possibly damaging 0.95
IGL02366:Abcc1 APN 16 14467979 splice site probably benign
IGL02431:Abcc1 APN 16 14419734 missense probably damaging 1.00
IGL02480:Abcc1 APN 16 14404005 missense possibly damaging 0.87
IGL02651:Abcc1 APN 16 14466126 missense probably benign 0.00
IGL02902:Abcc1 APN 16 14423127 missense probably damaging 1.00
IGL03101:Abcc1 APN 16 14389868 missense probably damaging 1.00
IGL03230:Abcc1 APN 16 14457947 missense probably benign
IGL03308:Abcc1 APN 16 14470611 missense possibly damaging 0.55
PIT4544001:Abcc1 UTSW 16 14405079 missense probably damaging 1.00
R0310:Abcc1 UTSW 16 14410927 missense probably damaging 0.98
R0594:Abcc1 UTSW 16 14389880 missense probably benign 0.05
R0894:Abcc1 UTSW 16 14465137 missense possibly damaging 0.64
R0928:Abcc1 UTSW 16 14389985 critical splice donor site probably null
R1367:Abcc1 UTSW 16 14443386 missense probably damaging 1.00
R1496:Abcc1 UTSW 16 14448434 missense probably damaging 1.00
R1643:Abcc1 UTSW 16 14413368 missense probably damaging 1.00
R1795:Abcc1 UTSW 16 14465137 missense possibly damaging 0.64
R1834:Abcc1 UTSW 16 14423117 missense possibly damaging 0.88
R1847:Abcc1 UTSW 16 14445449 missense probably benign 0.02
R1959:Abcc1 UTSW 16 14396393 missense probably damaging 1.00
R1961:Abcc1 UTSW 16 14396393 missense probably damaging 1.00
R2017:Abcc1 UTSW 16 14461204 missense probably damaging 1.00
R2224:Abcc1 UTSW 16 14472068 missense probably damaging 1.00
R2377:Abcc1 UTSW 16 14467923 missense probably damaging 0.97
R2513:Abcc1 UTSW 16 14473009 splice site probably null
R2876:Abcc1 UTSW 16 14457960 missense probably benign
R3003:Abcc1 UTSW 16 14436529 missense probably damaging 1.00
R4119:Abcc1 UTSW 16 14394013 missense probably benign 0.43
R4191:Abcc1 UTSW 16 14389864 missense probably damaging 1.00
R4369:Abcc1 UTSW 16 14460993 missense possibly damaging 0.88
R4428:Abcc1 UTSW 16 14445300 missense probably damaging 0.97
R4589:Abcc1 UTSW 16 14394031 missense probably benign 0.00
R4779:Abcc1 UTSW 16 14410771 missense probably benign 0.35
R5027:Abcc1 UTSW 16 14404053 critical splice donor site probably null
R5275:Abcc1 UTSW 16 14466186 missense probably damaging 1.00
R5418:Abcc1 UTSW 16 14461132 missense probably benign 0.02
R5490:Abcc1 UTSW 16 14410917 missense probably damaging 1.00
R5527:Abcc1 UTSW 16 14460978 missense probably benign 0.18
R5641:Abcc1 UTSW 16 14472013 missense probably benign 0.00
R5642:Abcc1 UTSW 16 14443455 missense probably damaging 1.00
R5875:Abcc1 UTSW 16 14467037 missense possibly damaging 0.94
R5916:Abcc1 UTSW 16 14465142 missense possibly damaging 0.95
R6112:Abcc1 UTSW 16 14460916 missense probably damaging 1.00
R6331:Abcc1 UTSW 16 14465056 missense probably damaging 0.97
R6464:Abcc1 UTSW 16 14447490 missense probably damaging 1.00
R6950:Abcc1 UTSW 16 14411616 missense probably damaging 1.00
R7024:Abcc1 UTSW 16 14413383 critical splice donor site probably null
R7115:Abcc1 UTSW 16 14437725 missense probably benign 0.11
R7187:Abcc1 UTSW 16 14466997 missense probably benign
R7298:Abcc1 UTSW 16 14396472 missense possibly damaging 0.89
R7342:Abcc1 UTSW 16 14465169 missense probably damaging 0.99
R7474:Abcc1 UTSW 16 14472986 missense possibly damaging 0.95
R7488:Abcc1 UTSW 16 14389899 nonsense probably null
R7583:Abcc1 UTSW 16 14404038 missense probably damaging 1.00
R7619:Abcc1 UTSW 16 14445419 missense probably damaging 0.96
R7971:Abcc1 UTSW 16 14448579 missense probably benign
R8048:Abcc1 UTSW 16 14410844 missense probably damaging 1.00
R8138:Abcc1 UTSW 16 14472887 missense probably damaging 0.99
R8159:Abcc1 UTSW 16 14472930 missense probably damaging 0.96
R8319:Abcc1 UTSW 16 14396451 missense probably damaging 1.00
X0026:Abcc1 UTSW 16 14459902 missense possibly damaging 0.94
Z1088:Abcc1 UTSW 16 14410809 missense probably benign 0.01
Z1177:Abcc1 UTSW 16 14411493 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGACATCTCATGCCATTTTGG -3'
(R):5'- GCAATGTGAGTCTGCATTGG -3'

Sequencing Primer
(F):5'- GGGCCCCCACCACTGAAC -3'
(R):5'- GGGGCTCAGAACAAGTACCC -3'
Posted On2015-04-17