Incidental Mutation 'R3918:Adhfe1'
ID307482
Institutional Source Beutler Lab
Gene Symbol Adhfe1
Ensembl Gene ENSMUSG00000025911
Gene Namealcohol dehydrogenase, iron containing, 1
Synonyms6330565B14Rik
MMRRC Submission 040816-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R3918 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location9547948-9580673 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 9576216 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 447 (R447H)
Ref Sequence ENSEMBL: ENSMUSP00000116627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027044] [ENSMUST00000144177]
Predicted Effect probably benign
Transcript: ENSMUST00000027044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121942
Predicted Effect probably damaging
Transcript: ENSMUST00000144177
AA Change: R447H

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116627
Gene: ENSMUSG00000025911
AA Change: R447H

DomainStartEndE-ValueType
Pfam:Fe-ADH 50 454 2.1e-105 PFAM
Pfam:Fe-ADH_2 53 155 6.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145176
Predicted Effect unknown
Transcript: ENSMUST00000190654
AA Change: R438H
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The ADHFE1 gene encodes hydroxyacid-oxoacid transhydrogenase (EC 1.1.99.24), which is responsible for the oxidation of 4-hydroxybutyrate in mammalian tissues (Kardon et al., 2006 [PubMed 16616524]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T C 8: 111,040,142 I52T probably damaging Het
Ak7 A G 12: 105,710,256 K72E probably benign Het
Best2 T G 8: 85,009,724 D270A probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Col18a1 T C 10: 77,053,358 M1721V probably benign Het
Ctnnal1 T C 4: 56,865,000 T39A possibly damaging Het
Dnah9 T A 11: 65,870,974 M3897L possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Egf T C 3: 129,696,860 I395V probably null Het
Fbln5 C T 12: 101,750,791 G446D probably damaging Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Hmcn1 G C 1: 150,690,610 T2214S probably benign Het
Lef1 A G 3: 131,111,641 N57S probably damaging Het
Lpin1 A G 12: 16,571,189 S266P probably benign Het
Marveld2 T C 13: 100,611,893 Q226R probably benign Het
Mest G A 6: 30,742,750 S132N probably benign Het
Mras T A 9: 99,411,420 I56F probably damaging Het
Myh13 G A 11: 67,329,238 E138K probably benign Het
Nsun2 A G 13: 69,630,680 T516A probably damaging Het
Ola1 A G 2: 73,142,339 V200A probably benign Het
Olfr994 A T 2: 85,430,730 V33D possibly damaging Het
Patj C A 4: 98,456,218 P20H probably damaging Het
Pcdhb12 T A 18: 37,437,048 W416R probably benign Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pola1 C A X: 93,461,472 R1313L probably benign Het
Ppp1r36 G A 12: 76,417,657 V10I probably benign Het
Rnf150 C T 8: 82,864,461 T151I probably benign Het
Tank G T 2: 61,643,786 probably null Het
Tmprss4 C T 9: 45,180,666 V174M probably benign Het
Trappc13 T C 13: 104,161,082 T105A probably damaging Het
Txndc9 G A 1: 37,994,050 Q84* probably null Het
Ubr3 A T 2: 70,016,130 probably null Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Zcchc6 A G 13: 59,782,024 S1066P probably damaging Het
Zfp51 A G 17: 21,463,440 K106E probably benign Het
Other mutations in Adhfe1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01353:Adhfe1 APN 1 9566863 missense probably benign
IGL01735:Adhfe1 APN 1 9548148 missense possibly damaging 0.90
IGL02862:Adhfe1 APN 1 9553811 missense probably damaging 1.00
IGL02891:Adhfe1 APN 1 9558171 missense probably benign
IGL03198:Adhfe1 APN 1 9549952 splice site probably benign
IGL03297:Adhfe1 APN 1 9549948 splice site probably benign
R0095:Adhfe1 UTSW 1 9560177 missense possibly damaging 0.79
R0180:Adhfe1 UTSW 1 9563857 missense probably benign 0.00
R0347:Adhfe1 UTSW 1 9553430 missense probably benign 0.00
R0590:Adhfe1 UTSW 1 9548153 critical splice donor site probably null
R1509:Adhfe1 UTSW 1 9553446 missense probably benign 0.03
R1606:Adhfe1 UTSW 1 9553473 critical splice donor site probably null
R1720:Adhfe1 UTSW 1 9566900 missense probably benign 0.01
R2048:Adhfe1 UTSW 1 9563553 missense probably benign 0.00
R4375:Adhfe1 UTSW 1 9561628 intron probably benign
R4576:Adhfe1 UTSW 1 9553754 missense probably damaging 1.00
R4653:Adhfe1 UTSW 1 9550578 intron probably benign
R4724:Adhfe1 UTSW 1 9576250 missense probably damaging 0.99
R4760:Adhfe1 UTSW 1 9563523 missense probably damaging 0.97
R4859:Adhfe1 UTSW 1 9558213 missense probably damaging 1.00
R4967:Adhfe1 UTSW 1 9566804 missense probably benign 0.11
R4970:Adhfe1 UTSW 1 9558238 missense possibly damaging 0.92
R5087:Adhfe1 UTSW 1 9561626 intron probably benign
R6146:Adhfe1 UTSW 1 9553718 missense probably damaging 0.98
R7013:Adhfe1 UTSW 1 9550591 intron probably benign
R7084:Adhfe1 UTSW 1 9566805 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGGTATATTGCCCTGTAAATTGTGG -3'
(R):5'- ACCAGCAATAGGTGAGTTAAGTGTG -3'

Sequencing Primer
(F):5'- CCCTGTAAATTGTGGTAGTGGTAC -3'
(R):5'- TGTGGAGATAAGACGGCAACATC -3'
Posted On2015-04-17