Mutagenetix > Incidental Mutations

Incidental Mutation 'R3918:Brinp3'

307485

Institutional Source

Beutler Lab

Gene Symbol

Brinp3

Ensembl Gene

ENSMUSG00000035131

Gene Name

bone morphogenetic protein/retinoic acid inducible neural specific 3

Synonyms

Fam5c, B830045N13Rik

MMRRC Submission

040816-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.284) question?

Stock #

R3918 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

146494760-146902472 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 146751861 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 277 (D277E)

Ref Sequence

ENSEMBL: ENSMUSP00000126074 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074622] [ENSMUST00000128345] [ENSMUST00000132847] [ENSMUST00000166814]

AlphaFold

Q499E0

Predicted Effect

probably damaging
Transcript: ENSMUST00000074622
AA Change: D277E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000074201
Gene: ENSMUSG00000035131
AA Change: D277E

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
MACPF	78	264	7.69e-42	SMART
low complexity region	315	326	N/A	INTRINSIC
coiled coil region	349	372	N/A	INTRINSIC
EGF	440	475	1.73e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000128345

SMART Domains

Protein: ENSMUSP00000116763
Gene: ENSMUSG00000035131

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000132847

SMART Domains

Protein: ENSMUSP00000118552
Gene: ENSMUSG00000035131

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Blast:MACPF	78	110	1e-16	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000166814
AA Change: D277E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000126074
Gene: ENSMUSG00000035131
AA Change: D277E

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
MACPF	78	264	7.69e-42	SMART
low complexity region	315	326	N/A	INTRINSIC
coiled coil region	349	372	N/A	INTRINSIC
EGF	440	475	1.73e1	SMART

Meta Mutation Damage Score

0.1478

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is overexpressed in pituitary tumors but is underexpressed in tongue squamous cell carcinomas, ulcerative colitis, and peri-implantitis. Polymorphisms that increase expression of this gene have been shown to increase vascular inflammation, and an association of this gene with myocardial infarction has been demonstrated. Finally, hypermethylation of this gene may find usefulness as a biomarker for gastric cancer. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars	T	C	8: 111,040,142	I52T	probably damaging	Het
Adhfe1	G	A	1: 9,576,216	R447H	probably damaging	Het
Ak7	A	G	12: 105,710,256	K72E	probably benign	Het
Best2	T	G	8: 85,009,724	D270A	probably damaging	Het
Col18a1	T	C	10: 77,053,358	M1721V	probably benign	Het
Ctnnal1	T	C	4: 56,865,000	T39A	possibly damaging	Het
Dnah9	T	A	11: 65,870,974	M3897L	possibly damaging	Het
Dysf	G	A	6: 84,186,509		probably null	Het
Egf	T	C	3: 129,696,860	I395V	probably null	Het
Fbln5	C	T	12: 101,750,791	G446D	probably damaging	Het
Gprc6a	CAAA	CA	10: 51,615,680		probably null	Het
Hmcn1	G	C	1: 150,690,610	T2214S	probably benign	Het
Lef1	A	G	3: 131,111,641	N57S	probably damaging	Het
Lpin1	A	G	12: 16,571,189	S266P	probably benign	Het
Marveld2	T	C	13: 100,611,893	Q226R	probably benign	Het
Mest	G	A	6: 30,742,750	S132N	probably benign	Het
Mras	T	A	9: 99,411,420	I56F	probably damaging	Het
Myh13	G	A	11: 67,329,238	E138K	probably benign	Het
Nsun2	A	G	13: 69,630,680	T516A	probably damaging	Het
Ola1	A	G	2: 73,142,339	V200A	probably benign	Het
Olfr994	A	T	2: 85,430,730	V33D	possibly damaging	Het
Patj	C	A	4: 98,456,218	P20H	probably damaging	Het
Pcdhb12	T	A	18: 37,437,048	W416R	probably benign	Het
Pcdhga9	G	A	18: 37,738,942	R608H	probably benign	Het
Pola1	C	A	X: 93,461,472	R1313L	probably benign	Het
Ppp1r36	G	A	12: 76,417,657	V10I	probably benign	Het
Rnf150	C	T	8: 82,864,461	T151I	probably benign	Het
Tank	G	T	2: 61,643,786		probably null	Het
Tmprss4	C	T	9: 45,180,666	V174M	probably benign	Het
Trappc13	T	C	13: 104,161,082	T105A	probably damaging	Het
Txndc9	G	A	1: 37,994,050	Q84*	probably null	Het
Ubr3	A	T	2: 70,016,130		probably null	Het
Wfs1	C	A	5: 36,968,624	V308L	probably benign	Het
Zcchc6	A	G	13: 59,782,024	S1066P	probably damaging	Het
Zfp51	A	G	17: 21,463,440	K106E	probably benign	Het

Other mutations in Brinp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Brinp3	APN	1	146901774	missense	probably damaging	0.99
IGL00503:Brinp3	APN	1	146901167	missense	probably benign
IGL01702:Brinp3	APN	1	146751997	splice site	probably benign
IGL01728:Brinp3	APN	1	146831551	splice site	probably null
IGL01733:Brinp3	APN	1	146514803	missense	probably benign	0.33
IGL01937:Brinp3	APN	1	146901140	missense	probably benign
IGL02020:Brinp3	APN	1	146902127	utr 3 prime	probably benign
IGL02082:Brinp3	APN	1	146751862	missense	probably damaging	1.00
IGL02365:Brinp3	APN	1	146901122	missense	probably benign	0.00
IGL02366:Brinp3	APN	1	146701743	missense	possibly damaging	0.84
IGL02565:Brinp3	APN	1	146902032	missense	probably damaging	0.98
IGL02999:Brinp3	APN	1	146701849	splice site	probably null
IGL03099:Brinp3	APN	1	146902097	missense	possibly damaging	0.91
PIT4283001:Brinp3	UTSW	1	146901423	missense	probably damaging	0.99
PIT4418001:Brinp3	UTSW	1	146901423	missense	probably damaging	0.99
R0021:Brinp3	UTSW	1	146901451	missense	probably benign	0.04
R0021:Brinp3	UTSW	1	146901451	missense	probably benign	0.04
R0266:Brinp3	UTSW	1	146682680	nonsense	probably null
R1468:Brinp3	UTSW	1	146901962	missense	probably benign	0.01
R1468:Brinp3	UTSW	1	146901962	missense	probably benign	0.01
R1522:Brinp3	UTSW	1	146901890	missense	probably damaging	0.99
R1596:Brinp3	UTSW	1	146514782	missense	probably benign
R1898:Brinp3	UTSW	1	146901249	missense	possibly damaging	0.93
R2036:Brinp3	UTSW	1	146701841	missense	possibly damaging	0.84
R2224:Brinp3	UTSW	1	146901920	nonsense	probably null
R2272:Brinp3	UTSW	1	146901404	missense	possibly damaging	0.93
R2291:Brinp3	UTSW	1	146901074	missense	possibly damaging	0.85
R2322:Brinp3	UTSW	1	146701754	missense	probably benign
R2880:Brinp3	UTSW	1	146902002	missense	probably damaging	0.98
R3939:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3940:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3941:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3942:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R4095:Brinp3	UTSW	1	146901692	missense	possibly damaging	0.72
R4783:Brinp3	UTSW	1	146727640	intron	probably benign
R5009:Brinp3	UTSW	1	146901049	missense	probably benign	0.25
R5034:Brinp3	UTSW	1	146727720	intron	probably benign
R5166:Brinp3	UTSW	1	146901367	missense	probably damaging	0.96
R5372:Brinp3	UTSW	1	146831726	missense	probably damaging	1.00
R5472:Brinp3	UTSW	1	146901459	missense	possibly damaging	0.86
R5651:Brinp3	UTSW	1	146701799	missense	probably benign	0.01
R5681:Brinp3	UTSW	1	146901746	missense	probably benign	0.12
R6351:Brinp3	UTSW	1	146901585	missense	probably damaging	0.96
R6470:Brinp3	UTSW	1	146901906	missense	probably damaging	0.99
R6499:Brinp3	UTSW	1	146901693	missense	possibly damaging	0.86
R7078:Brinp3	UTSW	1	146514889	nonsense	probably null
R7223:Brinp3	UTSW	1	146901074	missense	possibly damaging	0.85
R7322:Brinp3	UTSW	1	146682688	nonsense	probably null
R7347:Brinp3	UTSW	1	146902086	missense	probably benign	0.22
R7375:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7412:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7532:Brinp3	UTSW	1	146901401	missense	probably damaging	0.98
R7562:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7576:Brinp3	UTSW	1	146901563	missense	probably damaging	0.99
R7723:Brinp3	UTSW	1	146701671	missense	probably damaging	1.00
R7737:Brinp3	UTSW	1	146682594	missense	probably damaging	0.98
R7793:Brinp3	UTSW	1	146746568	missense	probably benign	0.20
R8334:Brinp3	UTSW	1	146902053	missense	probably damaging	0.99
R8401:Brinp3	UTSW	1	146901446	missense	probably benign	0.17
R9205:Brinp3	UTSW	1	146902089	missense	possibly damaging	0.57
R9328:Brinp3	UTSW	1	146831717	missense	probably damaging	0.98
X0060:Brinp3	UTSW	1	146901786	missense	probably benign	0.01
Z1176:Brinp3	UTSW	1	146902076	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTTCTCTACTCAGGGTGTTGTAAAC -3'
(R):5'- AGTTTCAACAGGAGCAATCAGTC -3'

Sequencing Primer
(F):5'- CTACTCAGGGTGTTGTAAACAAGTGC -3'
(R):5'- TCGTATTTTTGGGGCAAGACACAC -3'

Posted On

2015-04-17