Incidental Mutation 'R3918:Brinp3'
ID 307485
Institutional Source Beutler Lab
Gene Symbol Brinp3
Ensembl Gene ENSMUSG00000035131
Gene Name bone morphogenetic protein/retinoic acid inducible neural specific 3
Synonyms Fam5c, B830045N13Rik
MMRRC Submission 040816-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.152) question?
Stock # R3918 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 146494760-146902472 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 146751861 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 277 (D277E)
Ref Sequence ENSEMBL: ENSMUSP00000126074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074622] [ENSMUST00000128345] [ENSMUST00000132847] [ENSMUST00000166814]
AlphaFold Q499E0
Predicted Effect probably damaging
Transcript: ENSMUST00000074622
AA Change: D277E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074201
Gene: ENSMUSG00000035131
AA Change: D277E

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
MACPF 78 264 7.69e-42 SMART
low complexity region 315 326 N/A INTRINSIC
coiled coil region 349 372 N/A INTRINSIC
EGF 440 475 1.73e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128345
SMART Domains Protein: ENSMUSP00000116763
Gene: ENSMUSG00000035131

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132847
SMART Domains Protein: ENSMUSP00000118552
Gene: ENSMUSG00000035131

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Blast:MACPF 78 110 1e-16 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000166814
AA Change: D277E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126074
Gene: ENSMUSG00000035131
AA Change: D277E

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
MACPF 78 264 7.69e-42 SMART
low complexity region 315 326 N/A INTRINSIC
coiled coil region 349 372 N/A INTRINSIC
EGF 440 475 1.73e1 SMART
Meta Mutation Damage Score 0.1478 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is overexpressed in pituitary tumors but is underexpressed in tongue squamous cell carcinomas, ulcerative colitis, and peri-implantitis. Polymorphisms that increase expression of this gene have been shown to increase vascular inflammation, and an association of this gene with myocardial infarction has been demonstrated. Finally, hypermethylation of this gene may find usefulness as a biomarker for gastric cancer. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T C 8: 111,040,142 I52T probably damaging Het
Adhfe1 G A 1: 9,576,216 R447H probably damaging Het
Ak7 A G 12: 105,710,256 K72E probably benign Het
Best2 T G 8: 85,009,724 D270A probably damaging Het
Col18a1 T C 10: 77,053,358 M1721V probably benign Het
Ctnnal1 T C 4: 56,865,000 T39A possibly damaging Het
Dnah9 T A 11: 65,870,974 M3897L possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Egf T C 3: 129,696,860 I395V probably null Het
Fbln5 C T 12: 101,750,791 G446D probably damaging Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Hmcn1 G C 1: 150,690,610 T2214S probably benign Het
Lef1 A G 3: 131,111,641 N57S probably damaging Het
Lpin1 A G 12: 16,571,189 S266P probably benign Het
Marveld2 T C 13: 100,611,893 Q226R probably benign Het
Mest G A 6: 30,742,750 S132N probably benign Het
Mras T A 9: 99,411,420 I56F probably damaging Het
Myh13 G A 11: 67,329,238 E138K probably benign Het
Nsun2 A G 13: 69,630,680 T516A probably damaging Het
Ola1 A G 2: 73,142,339 V200A probably benign Het
Olfr994 A T 2: 85,430,730 V33D possibly damaging Het
Patj C A 4: 98,456,218 P20H probably damaging Het
Pcdhb12 T A 18: 37,437,048 W416R probably benign Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pola1 C A X: 93,461,472 R1313L probably benign Het
Ppp1r36 G A 12: 76,417,657 V10I probably benign Het
Rnf150 C T 8: 82,864,461 T151I probably benign Het
Tank G T 2: 61,643,786 probably null Het
Tmprss4 C T 9: 45,180,666 V174M probably benign Het
Trappc13 T C 13: 104,161,082 T105A probably damaging Het
Txndc9 G A 1: 37,994,050 Q84* probably null Het
Ubr3 A T 2: 70,016,130 probably null Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Zcchc6 A G 13: 59,782,024 S1066P probably damaging Het
Zfp51 A G 17: 21,463,440 K106E probably benign Het
Other mutations in Brinp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Brinp3 APN 1 146901774 missense probably damaging 0.99
IGL00503:Brinp3 APN 1 146901167 missense probably benign
IGL01702:Brinp3 APN 1 146751997 splice site probably benign
IGL01728:Brinp3 APN 1 146831551 splice site probably null
IGL01733:Brinp3 APN 1 146514803 missense probably benign 0.33
IGL01937:Brinp3 APN 1 146901140 missense probably benign
IGL02020:Brinp3 APN 1 146902127 utr 3 prime probably benign
IGL02082:Brinp3 APN 1 146751862 missense probably damaging 1.00
IGL02365:Brinp3 APN 1 146901122 missense probably benign 0.00
IGL02366:Brinp3 APN 1 146701743 missense possibly damaging 0.84
IGL02565:Brinp3 APN 1 146902032 missense probably damaging 0.98
IGL02999:Brinp3 APN 1 146701849 splice site probably null
IGL03099:Brinp3 APN 1 146902097 missense possibly damaging 0.91
PIT4283001:Brinp3 UTSW 1 146901423 missense probably damaging 0.99
PIT4418001:Brinp3 UTSW 1 146901423 missense probably damaging 0.99
R0021:Brinp3 UTSW 1 146901451 missense probably benign 0.04
R0021:Brinp3 UTSW 1 146901451 missense probably benign 0.04
R0266:Brinp3 UTSW 1 146682680 nonsense probably null
R1468:Brinp3 UTSW 1 146901962 missense probably benign 0.01
R1468:Brinp3 UTSW 1 146901962 missense probably benign 0.01
R1522:Brinp3 UTSW 1 146901890 missense probably damaging 0.99
R1596:Brinp3 UTSW 1 146514782 missense probably benign
R1898:Brinp3 UTSW 1 146901249 missense possibly damaging 0.93
R2036:Brinp3 UTSW 1 146701841 missense possibly damaging 0.84
R2224:Brinp3 UTSW 1 146901920 nonsense probably null
R2272:Brinp3 UTSW 1 146901404 missense possibly damaging 0.93
R2291:Brinp3 UTSW 1 146901074 missense possibly damaging 0.85
R2322:Brinp3 UTSW 1 146701754 missense probably benign
R2880:Brinp3 UTSW 1 146902002 missense probably damaging 0.98
R3939:Brinp3 UTSW 1 146751861 missense probably damaging 0.99
R3940:Brinp3 UTSW 1 146751861 missense probably damaging 0.99
R3941:Brinp3 UTSW 1 146751861 missense probably damaging 0.99
R3942:Brinp3 UTSW 1 146751861 missense probably damaging 0.99
R4095:Brinp3 UTSW 1 146901692 missense possibly damaging 0.72
R4783:Brinp3 UTSW 1 146727640 intron probably benign
R5009:Brinp3 UTSW 1 146901049 missense probably benign 0.25
R5034:Brinp3 UTSW 1 146727720 intron probably benign
R5166:Brinp3 UTSW 1 146901367 missense probably damaging 0.96
R5372:Brinp3 UTSW 1 146831726 missense probably damaging 1.00
R5472:Brinp3 UTSW 1 146901459 missense possibly damaging 0.86
R5651:Brinp3 UTSW 1 146701799 missense probably benign 0.01
R5681:Brinp3 UTSW 1 146901746 missense probably benign 0.12
R6351:Brinp3 UTSW 1 146901585 missense probably damaging 0.96
R6470:Brinp3 UTSW 1 146901906 missense probably damaging 0.99
R6499:Brinp3 UTSW 1 146901693 missense possibly damaging 0.86
R7078:Brinp3 UTSW 1 146514889 nonsense probably null
R7223:Brinp3 UTSW 1 146901074 missense possibly damaging 0.85
R7322:Brinp3 UTSW 1 146682688 nonsense probably null
R7347:Brinp3 UTSW 1 146902086 missense probably benign 0.22
R7375:Brinp3 UTSW 1 146902010 missense possibly damaging 0.91
R7412:Brinp3 UTSW 1 146902010 missense possibly damaging 0.91
R7532:Brinp3 UTSW 1 146901401 missense probably damaging 0.98
R7562:Brinp3 UTSW 1 146902010 missense possibly damaging 0.91
R7576:Brinp3 UTSW 1 146901563 missense probably damaging 0.99
R7723:Brinp3 UTSW 1 146701671 missense probably damaging 1.00
R7737:Brinp3 UTSW 1 146682594 missense probably damaging 0.98
R7793:Brinp3 UTSW 1 146746568 missense probably benign 0.20
R8334:Brinp3 UTSW 1 146902053 missense probably damaging 0.99
R8401:Brinp3 UTSW 1 146901446 missense probably benign 0.17
R9205:Brinp3 UTSW 1 146902089 missense possibly damaging 0.57
R9328:Brinp3 UTSW 1 146831717 missense probably damaging 0.98
R9602:Brinp3 UTSW 1 146746496 missense probably damaging 1.00
X0060:Brinp3 UTSW 1 146901786 missense probably benign 0.01
Z1176:Brinp3 UTSW 1 146902076 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTCTCTACTCAGGGTGTTGTAAAC -3'
(R):5'- AGTTTCAACAGGAGCAATCAGTC -3'

Sequencing Primer
(F):5'- CTACTCAGGGTGTTGTAAACAAGTGC -3'
(R):5'- TCGTATTTTTGGGGCAAGACACAC -3'
Posted On 2015-04-17