Incidental Mutation 'R3918:Patj'
ID307495
Institutional Source Beutler Lab
Gene Symbol Patj
Ensembl Gene ENSMUSG00000061859
Gene NamePATJ, crumbs cell polarity complex component
SynonymsInadl, Cipp
MMRRC Submission 040816-MU
Accession Numbers

Genbank: NM_172696; MGI: 1277960

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3918 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location98395785-98719603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 98456218 bp
ZygosityHeterozygous
Amino Acid Change Proline to Histidine at position 20 (P20H)
Ref Sequence ENSEMBL: ENSMUSP00000102644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041284] [ENSMUST00000107029] [ENSMUST00000107030] [ENSMUST00000107033] [ENSMUST00000107034]
Predicted Effect probably damaging
Transcript: ENSMUST00000041284
AA Change: P593H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049176
Gene: ENSMUSG00000061859
AA Change: P593H

DomainStartEndE-ValueType
L27 8 68 6.53e-9 SMART
PDZ 143 221 1.78e-20 SMART
PDZ 256 328 1.15e-23 SMART
PDZ 374 453 3.15e-21 SMART
coiled coil region 486 513 N/A INTRINSIC
PDZ 570 641 1.28e-12 SMART
PDZ 696 775 9.5e-16 SMART
low complexity region 980 991 N/A INTRINSIC
low complexity region 1054 1062 N/A INTRINSIC
PDZ 1083 1166 8.65e-19 SMART
PDZ 1253 1328 6.12e-19 SMART
low complexity region 1356 1366 N/A INTRINSIC
low complexity region 1410 1428 N/A INTRINSIC
PDZ 1480 1555 4.36e-24 SMART
PDZ 1577 1650 2.49e-19 SMART
PDZ 1718 1795 2.13e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107029
AA Change: P20H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102644
Gene: ENSMUSG00000061859
AA Change: P20H

DomainStartEndE-ValueType
PDZ 1 68 1e-9 SMART
PDZ 123 202 4.7e-18 SMART
low complexity region 407 418 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
PDZ 510 593 4.3e-21 SMART
PDZ 680 755 2.9e-21 SMART
low complexity region 783 793 N/A INTRINSIC
low complexity region 837 855 N/A INTRINSIC
PDZ 907 982 2.2e-26 SMART
PDZ 1004 1077 1.2e-21 SMART
PDZ 1145 1222 1e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107030
SMART Domains Protein: ENSMUSP00000102645
Gene: ENSMUSG00000061859

DomainStartEndE-ValueType
L27 8 68 6.53e-9 SMART
PDZ 143 221 1.78e-20 SMART
PDZ 256 328 1.15e-23 SMART
PDZ 374 453 3.15e-21 SMART
coiled coil region 486 513 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107033
SMART Domains Protein: ENSMUSP00000102648
Gene: ENSMUSG00000061859

DomainStartEndE-ValueType
L27 8 68 6.53e-9 SMART
PDZ 143 221 1.78e-20 SMART
PDZ 256 328 1.15e-23 SMART
PDZ 374 453 3.15e-21 SMART
coiled coil region 486 513 N/A INTRINSIC
low complexity region 648 659 N/A INTRINSIC
low complexity region 722 730 N/A INTRINSIC
PDZ 751 834 8.65e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107034
AA Change: P589H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102649
Gene: ENSMUSG00000061859
AA Change: P589H

DomainStartEndE-ValueType
L27 8 68 6.53e-9 SMART
PDZ 143 221 1.78e-20 SMART
PDZ 256 328 1.15e-23 SMART
PDZ 374 453 3.15e-21 SMART
coiled coil region 486 513 N/A INTRINSIC
PDZ 566 637 1.28e-12 SMART
PDZ 692 771 9.5e-16 SMART
low complexity region 976 987 N/A INTRINSIC
low complexity region 1050 1058 N/A INTRINSIC
PDZ 1079 1162 8.65e-19 SMART
PDZ 1249 1324 6.12e-19 SMART
low complexity region 1352 1362 N/A INTRINSIC
low complexity region 1382 1400 N/A INTRINSIC
PDZ 1452 1499 7.78e0 SMART
Predicted Effect unknown
Transcript: ENSMUST00000142103
AA Change: P71H
SMART Domains Protein: ENSMUSP00000116021
Gene: ENSMUSG00000061859
AA Change: P71H

DomainStartEndE-ValueType
PDZ 49 120 1.28e-12 SMART
PDZ 175 254 9.5e-16 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a multivalent PDZ domain protein, which is expressed exclusively in brain and kidney. This protein selectively interacts with inward rectifier K+ (Kir) family members, N-methyl-D-aspartate receptor subunits, neurexins and neuroligins, as well as cell surface molecules enriched in synaptic membranes. Thus, this protein may serve as a scaffold that brings structurally diverse but functionally connected proteins into close proximity at the synapse. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T C 8: 111,040,142 I52T probably damaging Het
Adhfe1 G A 1: 9,576,216 R447H probably damaging Het
Ak7 A G 12: 105,710,256 K72E probably benign Het
Best2 T G 8: 85,009,724 D270A probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Col18a1 T C 10: 77,053,358 M1721V probably benign Het
Ctnnal1 T C 4: 56,865,000 T39A possibly damaging Het
Dnah9 T A 11: 65,870,974 M3897L possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Egf T C 3: 129,696,860 I395V probably null Het
Fbln5 C T 12: 101,750,791 G446D probably damaging Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Hmcn1 G C 1: 150,690,610 T2214S probably benign Het
Lef1 A G 3: 131,111,641 N57S probably damaging Het
Lpin1 A G 12: 16,571,189 S266P probably benign Het
Marveld2 T C 13: 100,611,893 Q226R probably benign Het
Mest G A 6: 30,742,750 S132N probably benign Het
Mras T A 9: 99,411,420 I56F probably damaging Het
Myh13 G A 11: 67,329,238 E138K probably benign Het
Nsun2 A G 13: 69,630,680 T516A probably damaging Het
Ola1 A G 2: 73,142,339 V200A probably benign Het
Olfr994 A T 2: 85,430,730 V33D possibly damaging Het
Pcdhb12 T A 18: 37,437,048 W416R probably benign Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pola1 C A X: 93,461,472 R1313L probably benign Het
Ppp1r36 G A 12: 76,417,657 V10I probably benign Het
Rnf150 C T 8: 82,864,461 T151I probably benign Het
Tank G T 2: 61,643,786 probably null Het
Tmprss4 C T 9: 45,180,666 V174M probably benign Het
Trappc13 T C 13: 104,161,082 T105A probably damaging Het
Txndc9 G A 1: 37,994,050 Q84* probably null Het
Ubr3 A T 2: 70,016,130 probably null Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Zcchc6 A G 13: 59,782,024 S1066P probably damaging Het
Zfp51 A G 17: 21,463,440 K106E probably benign Het
Other mutations in Patj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Patj APN 4 98465106 missense probably damaging 1.00
IGL00095:Patj APN 4 98535562 missense possibly damaging 0.78
IGL00517:Patj APN 4 98441071 missense possibly damaging 0.95
IGL00802:Patj APN 4 98424406 missense possibly damaging 0.93
IGL01064:Patj APN 4 98496973 missense possibly damaging 0.95
IGL01110:Patj APN 4 98413024 missense probably damaging 0.99
IGL01407:Patj APN 4 98413050 missense possibly damaging 0.49
IGL01821:Patj APN 4 98456211 missense probably damaging 1.00
IGL02399:Patj APN 4 98591936 missense probably damaging 1.00
IGL02494:Patj APN 4 98703987 splice site probably benign
IGL02803:Patj APN 4 98426064 missense probably damaging 0.99
IGL02931:Patj APN 4 98411173 splice site probably benign
IGL03017:Patj APN 4 98465027 splice site probably benign
IGL03115:Patj APN 4 98443803 missense probably damaging 1.00
IGL03209:Patj APN 4 98465140 missense probably null 1.00
IGL03377:Patj APN 4 98465104 missense probably damaging 1.00
D4186:Patj UTSW 4 98638762 missense probably benign 0.17
PIT4531001:Patj UTSW 4 98441090 missense probably damaging 0.98
R0136:Patj UTSW 4 98667648 missense probably damaging 1.00
R0294:Patj UTSW 4 98497048 missense probably damaging 0.99
R0376:Patj UTSW 4 98568987 missense probably damaging 1.00
R0463:Patj UTSW 4 98674308 missense probably damaging 1.00
R0465:Patj UTSW 4 98535507 splice site probably null
R0466:Patj UTSW 4 98688156 missense probably damaging 1.00
R0544:Patj UTSW 4 98569110 missense probably damaging 1.00
R0624:Patj UTSW 4 98681235 splice site probably benign
R0657:Patj UTSW 4 98667648 missense probably damaging 1.00
R1281:Patj UTSW 4 98416695 missense probably damaging 1.00
R1393:Patj UTSW 4 98424411 missense probably benign 0.01
R1480:Patj UTSW 4 98469582 missense probably damaging 1.00
R1667:Patj UTSW 4 98413027 missense probably damaging 1.00
R1728:Patj UTSW 4 98431780 missense possibly damaging 0.50
R1729:Patj UTSW 4 98431780 missense possibly damaging 0.50
R1797:Patj UTSW 4 98687438 missense probably damaging 1.00
R1818:Patj UTSW 4 98623648 missense possibly damaging 0.85
R1835:Patj UTSW 4 98491590 missense probably benign 0.00
R1880:Patj UTSW 4 98497240 missense probably benign 0.00
R2009:Patj UTSW 4 98456169 missense probably damaging 1.00
R2090:Patj UTSW 4 98437323 unclassified probably benign
R2120:Patj UTSW 4 98456225 missense probably benign 0.01
R2180:Patj UTSW 4 98523502 critical splice donor site probably null
R2655:Patj UTSW 4 98437450 missense possibly damaging 0.64
R3156:Patj UTSW 4 98674228 missense probably damaging 1.00
R3749:Patj UTSW 4 98469600 missense probably damaging 1.00
R3767:Patj UTSW 4 98681219 nonsense probably null
R3913:Patj UTSW 4 98569101 missense probably damaging 0.99
R3917:Patj UTSW 4 98592008 nonsense probably null
R4299:Patj UTSW 4 98677321 missense possibly damaging 0.89
R4355:Patj UTSW 4 98650454 missense possibly damaging 0.87
R4471:Patj UTSW 4 98535579 missense probably damaging 1.00
R4762:Patj UTSW 4 98405570 nonsense probably null
R4877:Patj UTSW 4 98569058 missense possibly damaging 0.94
R4945:Patj UTSW 4 98495064 missense probably damaging 0.97
R5274:Patj UTSW 4 98518981 missense probably damaging 0.99
R5343:Patj UTSW 4 98676193 missense probably damaging 1.00
R5554:Patj UTSW 4 98454396 missense possibly damaging 0.79
R5688:Patj UTSW 4 98520810 nonsense probably null
R5880:Patj UTSW 4 98411145 missense probably damaging 0.96
R5972:Patj UTSW 4 98569053 missense probably damaging 0.98
R6149:Patj UTSW 4 98424325 missense possibly damaging 0.72
R6192:Patj UTSW 4 98456157 missense probably damaging 1.00
R6265:Patj UTSW 4 98469567 missense probably benign 0.08
R6350:Patj UTSW 4 98405618 missense probably benign 0.26
R6363:Patj UTSW 4 98431860 missense probably benign 0.25
R6434:Patj UTSW 4 98491629 missense probably damaging 1.00
R6496:Patj UTSW 4 98416752 missense probably damaging 1.00
R6896:Patj UTSW 4 98426050 missense possibly damaging 0.87
R7039:Patj UTSW 4 98569078 missense probably damaging 0.96
R7040:Patj UTSW 4 98441080 missense probably benign 0.02
R7052:Patj UTSW 4 98677260 missense probably benign 0.03
R7066:Patj UTSW 4 98413197 missense probably benign 0.24
R7236:Patj UTSW 4 98411057 missense probably damaging 1.00
R7242:Patj UTSW 4 98591933 missense probably benign 0.26
R7260:Patj UTSW 4 98416733 missense possibly damaging 0.94
R7412:Patj UTSW 4 98411139 missense probably damaging 0.98
R7493:Patj UTSW 4 98495061 missense probably benign 0.41
R7570:Patj UTSW 4 98424500 splice site probably null
R7571:Patj UTSW 4 98568980 missense probably damaging 1.00
R7626:Patj UTSW 4 98546987 missense probably benign 0.35
R7658:Patj UTSW 4 98688179 missense probably damaging 1.00
R7664:Patj UTSW 4 98496950 missense possibly damaging 0.92
R7669:Patj UTSW 4 98518942 missense probably damaging 1.00
R7796:Patj UTSW 4 98546983 start codon destroyed probably benign 0.05
R7870:Patj UTSW 4 98424316 missense probably damaging 1.00
R7883:Patj UTSW 4 98611135 missense probably benign 0.00
R7953:Patj UTSW 4 98424316 missense probably damaging 1.00
R7966:Patj UTSW 4 98611135 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTTTCCTGTGCTGGGAATC -3'
(R):5'- CCCAGTAAGCTGTTGGTATTTCTTG -3'

Sequencing Primer
(F):5'- AATGCGGTTTCAGTGGCTAAATGAC -3'
(R):5'- ATTTCTTGGTATAAATGCCTGGC -3'
Posted On2015-04-17