Incidental Mutation 'R3918:Wfs1'
ID307496
Institutional Source Beutler Lab
Gene Symbol Wfs1
Ensembl Gene ENSMUSG00000039474
Gene Namewolframin ER transmembrane glycoprotein
Synonymswolframin
MMRRC Submission 040816-MU
Accession Numbers

Genbank: NM_011716; MGI: 1328355

Is this an essential gene? Possibly non essential (E-score: 0.440) question?
Stock #R3918 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location36966104-36989205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 36968624 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 308 (V308L)
Ref Sequence ENSEMBL: ENSMUSP00000048053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043964] [ENSMUST00000166339]
Predicted Effect probably benign
Transcript: ENSMUST00000043964
AA Change: V308L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000048053
Gene: ENSMUSG00000039474
AA Change: V308L

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
low complexity region 50 67 N/A INTRINSIC
Blast:SEL1 101 139 1e-8 BLAST
low complexity region 268 275 N/A INTRINSIC
transmembrane domain 313 335 N/A INTRINSIC
transmembrane domain 342 364 N/A INTRINSIC
transmembrane domain 407 424 N/A INTRINSIC
transmembrane domain 431 453 N/A INTRINSIC
transmembrane domain 495 517 N/A INTRINSIC
transmembrane domain 529 551 N/A INTRINSIC
transmembrane domain 561 583 N/A INTRINSIC
transmembrane domain 590 612 N/A INTRINSIC
transmembrane domain 632 654 N/A INTRINSIC
low complexity region 877 886 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166339
SMART Domains Protein: ENSMUSP00000132404
Gene: ENSMUSG00000039474

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
low complexity region 50 67 N/A INTRINSIC
Blast:SEL1 101 139 3e-8 BLAST
low complexity region 268 275 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
transmembrane domain 419 441 N/A INTRINSIC
transmembrane domain 453 475 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 514 536 N/A INTRINSIC
transmembrane domain 556 578 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167937
SMART Domains Protein: ENSMUSP00000125779
Gene: ENSMUSG00000039474

DomainStartEndE-ValueType
Blast:SEL1 20 58 4e-9 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein, which is located primarily in the endoplasmic reticulum and ubiquitously expressed with highest levels in brain, pancreas, heart, and insulinoma beta-cell lines. Mutations in this gene are associated with Wolfram syndrome, also called DIDMOAD (Diabetes Insipidus, Diabetes Mellitus, Optic Atrophy, and Deafness), an autosomal recessive disorder. The disease affects the brain and central nervous system. Mutations in this gene can also cause autosomal dominant deafness 6 (DFNA6), also known as DFNA14 or DFNA38. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased pancreatic beta cells and impaired glucose tolerance. Mice homozygous for a knock-out allele exhibit impaired glucose tolerance, decreased body weight, and abnormal behavior associated with increased sensitivity to stress. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(3) Gene trapped(1)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T C 8: 111,040,142 I52T probably damaging Het
Adhfe1 G A 1: 9,576,216 R447H probably damaging Het
Ak7 A G 12: 105,710,256 K72E probably benign Het
Best2 T G 8: 85,009,724 D270A probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Col18a1 T C 10: 77,053,358 M1721V probably benign Het
Ctnnal1 T C 4: 56,865,000 T39A possibly damaging Het
Dnah9 T A 11: 65,870,974 M3897L possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Egf T C 3: 129,696,860 I395V probably null Het
Fbln5 C T 12: 101,750,791 G446D probably damaging Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Hmcn1 G C 1: 150,690,610 T2214S probably benign Het
Lef1 A G 3: 131,111,641 N57S probably damaging Het
Lpin1 A G 12: 16,571,189 S266P probably benign Het
Marveld2 T C 13: 100,611,893 Q226R probably benign Het
Mest G A 6: 30,742,750 S132N probably benign Het
Mras T A 9: 99,411,420 I56F probably damaging Het
Myh13 G A 11: 67,329,238 E138K probably benign Het
Nsun2 A G 13: 69,630,680 T516A probably damaging Het
Ola1 A G 2: 73,142,339 V200A probably benign Het
Olfr994 A T 2: 85,430,730 V33D possibly damaging Het
Patj C A 4: 98,456,218 P20H probably damaging Het
Pcdhb12 T A 18: 37,437,048 W416R probably benign Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pola1 C A X: 93,461,472 R1313L probably benign Het
Ppp1r36 G A 12: 76,417,657 V10I probably benign Het
Rnf150 C T 8: 82,864,461 T151I probably benign Het
Tank G T 2: 61,643,786 probably null Het
Tmprss4 C T 9: 45,180,666 V174M probably benign Het
Trappc13 T C 13: 104,161,082 T105A probably damaging Het
Txndc9 G A 1: 37,994,050 Q84* probably null Het
Ubr3 A T 2: 70,016,130 probably null Het
Zcchc6 A G 13: 59,782,024 S1066P probably damaging Het
Zfp51 A G 17: 21,463,440 K106E probably benign Het
Other mutations in Wfs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Wfs1 APN 5 36967917 nonsense probably null
IGL01391:Wfs1 APN 5 36971563 missense probably benign 0.10
IGL01788:Wfs1 APN 5 36968636 missense probably benign 0.01
IGL02169:Wfs1 APN 5 36968479 missense probably damaging 0.99
IGL02814:Wfs1 APN 5 36967669 missense possibly damaging 0.88
IGL03294:Wfs1 APN 5 36975597 missense probably damaging 1.00
IGL03299:Wfs1 APN 5 36968387 nonsense probably null
2107:Wfs1 UTSW 5 36967273 missense probably damaging 1.00
R0077:Wfs1 UTSW 5 36973194 missense probably damaging 1.00
R0180:Wfs1 UTSW 5 36967028 missense probably damaging 0.96
R0402:Wfs1 UTSW 5 36976980 unclassified probably benign
R0458:Wfs1 UTSW 5 36968669 missense probably damaging 0.98
R0533:Wfs1 UTSW 5 36973722 splice site probably benign
R0890:Wfs1 UTSW 5 36975544 missense probably damaging 1.00
R0948:Wfs1 UTSW 5 36967561 missense probably damaging 1.00
R1413:Wfs1 UTSW 5 36982078 missense possibly damaging 0.65
R1759:Wfs1 UTSW 5 36967015 missense probably damaging 0.99
R2009:Wfs1 UTSW 5 36968309 missense probably damaging 0.96
R2137:Wfs1 UTSW 5 36967501 missense probably damaging 0.99
R2157:Wfs1 UTSW 5 36967942 missense probably damaging 1.00
R2216:Wfs1 UTSW 5 36967220 nonsense probably null
R3779:Wfs1 UTSW 5 36968624 missense probably benign 0.01
R3850:Wfs1 UTSW 5 36968624 missense probably benign 0.01
R3853:Wfs1 UTSW 5 36968624 missense probably benign 0.01
R4093:Wfs1 UTSW 5 36967465 missense probably damaging 0.97
R5056:Wfs1 UTSW 5 36975587 missense probably benign 0.00
R5849:Wfs1 UTSW 5 36973264 missense probably damaging 1.00
R5997:Wfs1 UTSW 5 36967750 missense probably damaging 0.99
R6666:Wfs1 UTSW 5 36967619 missense possibly damaging 0.94
R7024:Wfs1 UTSW 5 36966950 missense probably damaging 1.00
R7157:Wfs1 UTSW 5 36967172 missense probably benign 0.00
R7264:Wfs1 UTSW 5 36967846 missense probably damaging 1.00
R7269:Wfs1 UTSW 5 36967790 nonsense probably null
R7365:Wfs1 UTSW 5 36967732 missense probably benign 0.33
R7657:Wfs1 UTSW 5 36968234 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTACGGAAGTTCTCCCAGG -3'
(R):5'- GATCTGTTAGGATGAGGCCC -3'

Sequencing Primer
(F):5'- TGCTGTCCTGGAACACCTTGAG -3'
(R):5'- CTGTTAGGATGAGGCCCAGGAG -3'
Posted On2015-04-17