Incidental Mutation 'R3918:Mest'
ID307497
Institutional Source Beutler Lab
Gene Symbol Mest
Ensembl Gene ENSMUSG00000051855
Gene Namemesoderm specific transcript
SynonymsPeg1
MMRRC Submission 040816-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R3918 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location30723547-30748465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30742750 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 132 (S132N)
Ref Sequence ENSEMBL: ENSMUSP00000117713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048774] [ENSMUST00000115127] [ENSMUST00000124665] [ENSMUST00000147400] [ENSMUST00000151777] [ENSMUST00000157040] [ENSMUST00000163949]
Predicted Effect probably benign
Transcript: ENSMUST00000048774
SMART Domains Protein: ENSMUSP00000038368
Gene: ENSMUSG00000025607

DomainStartEndE-ValueType
Pfam:Adaptin_N 23 539 2.6e-134 PFAM
Pfam:COP-gamma_platf 609 756 7.7e-66 PFAM
Pfam:Coatomer_g_Cpla 758 870 1.6e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083567
Predicted Effect probably benign
Transcript: ENSMUST00000115127
SMART Domains Protein: ENSMUSP00000110780
Gene: ENSMUSG00000051855

DomainStartEndE-ValueType
SCOP:d1qo7a_ 23 107 3e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124665
AA Change: S132N

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000117713
Gene: ENSMUSG00000051855
AA Change: S132N

DomainStartEndE-ValueType
Pfam:DUF1057 50 183 3.9e-9 PFAM
Pfam:Abhydrolase_6 79 198 7.8e-21 PFAM
Pfam:Abhydrolase_1 104 191 4.9e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137521
Predicted Effect probably benign
Transcript: ENSMUST00000147400
AA Change: S117N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000120408
Gene: ENSMUSG00000051855
AA Change: S117N

DomainStartEndE-ValueType
Pfam:DUF1057 35 144 3.3e-9 PFAM
Pfam:Abhydrolase_6 64 145 3.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149496
Predicted Effect probably benign
Transcript: ENSMUST00000151777
SMART Domains Protein: ENSMUSP00000115541
Gene: ENSMUSG00000051855

DomainStartEndE-ValueType
SCOP:d1qo7a_ 42 133 1e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000157040
AA Change: S116N

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000119038
Gene: ENSMUSG00000051855
AA Change: S116N

DomainStartEndE-ValueType
Pfam:DUF1057 34 167 3.1e-9 PFAM
Pfam:Abhydrolase_6 63 182 6.2e-21 PFAM
Pfam:Abhydrolase_1 88 176 4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163949
AA Change: S125N

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000129639
Gene: ENSMUSG00000051855
AA Change: S125N

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:DUF1057 43 176 7.1e-9 PFAM
Pfam:Abhydrolase_1 70 321 2.5e-16 PFAM
Pfam:Abhydrolase_5 71 315 5.9e-9 PFAM
Pfam:Abhydrolase_6 72 327 7.1e-13 PFAM
Meta Mutation Damage Score 0.0749 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha/beta hydrolase superfamily. It is imprinted, exhibiting preferential expression from the paternal allele in fetal tissues, and isoform-specific imprinting in lymphocytes. The loss of imprinting of this gene has been linked to certain types of cancer and may be due to promotor switching. The encoded protein may play a role in development. Alternatively spliced transcript variants encoding multiple isoforms have been identified for this gene. Pseudogenes of this gene are located on the short arm of chromosomes 3 and 4, and the long arm of chromosomes 6 and 15. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit retardation of embryonic growth and subtle cardiac abnormalities associated with reduced postnatal survival rates. Mutant females exhibit abnormal maternal behavior and impaired placentophagia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T C 8: 111,040,142 I52T probably damaging Het
Adhfe1 G A 1: 9,576,216 R447H probably damaging Het
Ak7 A G 12: 105,710,256 K72E probably benign Het
Best2 T G 8: 85,009,724 D270A probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Col18a1 T C 10: 77,053,358 M1721V probably benign Het
Ctnnal1 T C 4: 56,865,000 T39A possibly damaging Het
Dnah9 T A 11: 65,870,974 M3897L possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Egf T C 3: 129,696,860 I395V probably null Het
Fbln5 C T 12: 101,750,791 G446D probably damaging Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Hmcn1 G C 1: 150,690,610 T2214S probably benign Het
Lef1 A G 3: 131,111,641 N57S probably damaging Het
Lpin1 A G 12: 16,571,189 S266P probably benign Het
Marveld2 T C 13: 100,611,893 Q226R probably benign Het
Mras T A 9: 99,411,420 I56F probably damaging Het
Myh13 G A 11: 67,329,238 E138K probably benign Het
Nsun2 A G 13: 69,630,680 T516A probably damaging Het
Ola1 A G 2: 73,142,339 V200A probably benign Het
Olfr994 A T 2: 85,430,730 V33D possibly damaging Het
Patj C A 4: 98,456,218 P20H probably damaging Het
Pcdhb12 T A 18: 37,437,048 W416R probably benign Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pola1 C A X: 93,461,472 R1313L probably benign Het
Ppp1r36 G A 12: 76,417,657 V10I probably benign Het
Rnf150 C T 8: 82,864,461 T151I probably benign Het
Tank G T 2: 61,643,786 probably null Het
Tmprss4 C T 9: 45,180,666 V174M probably benign Het
Trappc13 T C 13: 104,161,082 T105A probably damaging Het
Txndc9 G A 1: 37,994,050 Q84* probably null Het
Ubr3 A T 2: 70,016,130 probably null Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Zcchc6 A G 13: 59,782,024 S1066P probably damaging Het
Zfp51 A G 17: 21,463,440 K106E probably benign Het
Other mutations in Mest
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Mest APN 6 30746331 unclassified probably benign
IGL02231:Mest APN 6 30740773 missense possibly damaging 0.93
IGL02386:Mest APN 6 30744914 missense possibly damaging 0.65
R0102:Mest UTSW 6 30746270 missense probably damaging 1.00
R0102:Mest UTSW 6 30746270 missense probably damaging 1.00
R0826:Mest UTSW 6 30742814 missense probably damaging 1.00
R0972:Mest UTSW 6 30740684 nonsense probably null
R1580:Mest UTSW 6 30745823 unclassified probably benign
R1768:Mest UTSW 6 30745139 missense probably benign 0.01
R1835:Mest UTSW 6 30742791 missense probably benign 0.14
R2131:Mest UTSW 6 30745885 missense probably damaging 1.00
R3919:Mest UTSW 6 30742750 missense probably benign 0.07
R4544:Mest UTSW 6 30740680 missense probably damaging 1.00
R4546:Mest UTSW 6 30740680 missense probably damaging 1.00
R4647:Mest UTSW 6 30745110 nonsense probably null
R6818:Mest UTSW 6 30746287 missense probably damaging 1.00
R7048:Mest UTSW 6 30742724 missense probably damaging 1.00
R7158:Mest UTSW 6 30744914 missense possibly damaging 0.65
R7290:Mest UTSW 6 30747159 missense unknown
R7734:Mest UTSW 6 30746300 missense unknown
Z1177:Mest UTSW 6 30723575
Predicted Primers PCR Primer
(F):5'- GCTTTGGCTTCAGTGACAAGC -3'
(R):5'- AGCTCAGTAACTGACTCCCC -3'

Sequencing Primer
(F):5'- CTTCAGTGACAAGCCGGTAAGC -3'
(R):5'- GATGGTCCCAGAATACTTGAGTTTCC -3'
Posted On2015-04-17