Incidental Mutation 'R3918:Rnf150'
ID307500
Institutional Source Beutler Lab
Gene Symbol Rnf150
Ensembl Gene ENSMUSG00000047747
Gene Namering finger protein 150
SynonymsGreul5, A630007N06Rik, C030044C12Rik
MMRRC Submission 040816-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R3918 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location82863356-83091268 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 82864461 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 151 (T151I)
Ref Sequence ENSEMBL: ENSMUSP00000077610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078525]
Predicted Effect probably benign
Transcript: ENSMUST00000078525
AA Change: T151I

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000077610
Gene: ENSMUSG00000047747
AA Change: T151I

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
Pfam:PA 84 180 2.1e-12 PFAM
transmembrane domain 207 229 N/A INTRINSIC
RING 277 317 1.29e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211714
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T C 8: 111,040,142 I52T probably damaging Het
Adhfe1 G A 1: 9,576,216 R447H probably damaging Het
Ak7 A G 12: 105,710,256 K72E probably benign Het
Best2 T G 8: 85,009,724 D270A probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Col18a1 T C 10: 77,053,358 M1721V probably benign Het
Ctnnal1 T C 4: 56,865,000 T39A possibly damaging Het
Dnah9 T A 11: 65,870,974 M3897L possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Egf T C 3: 129,696,860 I395V probably null Het
Fbln5 C T 12: 101,750,791 G446D probably damaging Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Hmcn1 G C 1: 150,690,610 T2214S probably benign Het
Lef1 A G 3: 131,111,641 N57S probably damaging Het
Lpin1 A G 12: 16,571,189 S266P probably benign Het
Marveld2 T C 13: 100,611,893 Q226R probably benign Het
Mest G A 6: 30,742,750 S132N probably benign Het
Mras T A 9: 99,411,420 I56F probably damaging Het
Myh13 G A 11: 67,329,238 E138K probably benign Het
Nsun2 A G 13: 69,630,680 T516A probably damaging Het
Ola1 A G 2: 73,142,339 V200A probably benign Het
Olfr994 A T 2: 85,430,730 V33D possibly damaging Het
Patj C A 4: 98,456,218 P20H probably damaging Het
Pcdhb12 T A 18: 37,437,048 W416R probably benign Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pola1 C A X: 93,461,472 R1313L probably benign Het
Ppp1r36 G A 12: 76,417,657 V10I probably benign Het
Tank G T 2: 61,643,786 probably null Het
Tmprss4 C T 9: 45,180,666 V174M probably benign Het
Trappc13 T C 13: 104,161,082 T105A probably damaging Het
Txndc9 G A 1: 37,994,050 Q84* probably null Het
Ubr3 A T 2: 70,016,130 probably null Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Zcchc6 A G 13: 59,782,024 S1066P probably damaging Het
Zfp51 A G 17: 21,463,440 K106E probably benign Het
Other mutations in Rnf150
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02183:Rnf150 APN 8 83003605 missense probably damaging 0.96
R0512:Rnf150 UTSW 8 82864178 missense probably benign 0.01
R1848:Rnf150 UTSW 8 82864010 start codon destroyed possibly damaging 0.67
R2078:Rnf150 UTSW 8 83003605 missense probably damaging 0.96
R2192:Rnf150 UTSW 8 82864391 missense probably damaging 0.98
R4365:Rnf150 UTSW 8 82864115 missense probably benign 0.05
R4781:Rnf150 UTSW 8 82864152 missense probably damaging 1.00
R4810:Rnf150 UTSW 8 82990362 missense possibly damaging 0.66
R4859:Rnf150 UTSW 8 82864083 missense probably damaging 1.00
R5677:Rnf150 UTSW 8 83003599 nonsense probably null
R6022:Rnf150 UTSW 8 83042729 missense probably benign 0.00
R6241:Rnf150 UTSW 8 82864464 missense possibly damaging 0.82
R6283:Rnf150 UTSW 8 82990554 missense probably damaging 1.00
R6306:Rnf150 UTSW 8 83083502 missense possibly damaging 0.90
R7014:Rnf150 UTSW 8 83042663 missense probably benign
R7023:Rnf150 UTSW 8 82864077 missense probably damaging 0.97
R7394:Rnf150 UTSW 8 82990471 nonsense probably null
R7710:Rnf150 UTSW 8 82864152 missense probably damaging 1.00
R7771:Rnf150 UTSW 8 82864203 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCACCTATTTGGAGCCCGAG -3'
(R):5'- AACCTCTCATGCTTGTAACCTG -3'

Sequencing Primer
(F):5'- TGGTCATGGCCAGCTCG -3'
(R):5'- TGTAACCTGTCCCCCAAGCG -3'
Posted On2015-04-17