Incidental Mutation 'R3918:Best2'
ID307501
Institutional Source Beutler Lab
Gene Symbol Best2
Ensembl Gene ENSMUSG00000052819
Gene Namebestrophin 2
SynonymsVmd2l1
MMRRC Submission 040816-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R3918 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location85007202-85014531 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 85009724 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 270 (D270A)
Ref Sequence ENSEMBL: ENSMUSP00000147837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059072] [ENSMUST00000209322] [ENSMUST00000209421]
Predicted Effect probably damaging
Transcript: ENSMUST00000059072
AA Change: D270A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053408
Gene: ENSMUSG00000052819
AA Change: D270A

DomainStartEndE-ValueType
Pfam:Bestrophin 8 316 5.8e-118 PFAM
low complexity region 340 352 N/A INTRINSIC
low complexity region 408 417 N/A INTRINSIC
low complexity region 428 447 N/A INTRINSIC
low complexity region 457 479 N/A INTRINSIC
low complexity region 484 501 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000209322
AA Change: D270A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000209421
AA Change: D270A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the bestrophin gene family of anion channels. Bestrophin genes share a similar gene structure with highly conserved exon-intron boundaries, but with distinct 3' ends. Bestrophins are transmembrane proteins that contain a homologous region rich in aromatic residues, including an invariant arg-phe-pro motif. Mutation in one of the family members (bestrophin 1) is associated with vitelliform macular dystrophy. The bestrophin 2 gene is mainly expressed in the retinal pigment epithelium and colon. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit ocular hypotension. Both heterozygous and homozygous null mice show a greater reduction in intraocular pressure following treatment with brinzolamide. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T C 8: 111,040,142 I52T probably damaging Het
Adhfe1 G A 1: 9,576,216 R447H probably damaging Het
Ak7 A G 12: 105,710,256 K72E probably benign Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Col18a1 T C 10: 77,053,358 M1721V probably benign Het
Ctnnal1 T C 4: 56,865,000 T39A possibly damaging Het
Dnah9 T A 11: 65,870,974 M3897L possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Egf T C 3: 129,696,860 I395V probably null Het
Fbln5 C T 12: 101,750,791 G446D probably damaging Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Hmcn1 G C 1: 150,690,610 T2214S probably benign Het
Lef1 A G 3: 131,111,641 N57S probably damaging Het
Lpin1 A G 12: 16,571,189 S266P probably benign Het
Marveld2 T C 13: 100,611,893 Q226R probably benign Het
Mest G A 6: 30,742,750 S132N probably benign Het
Mras T A 9: 99,411,420 I56F probably damaging Het
Myh13 G A 11: 67,329,238 E138K probably benign Het
Nsun2 A G 13: 69,630,680 T516A probably damaging Het
Ola1 A G 2: 73,142,339 V200A probably benign Het
Olfr994 A T 2: 85,430,730 V33D possibly damaging Het
Patj C A 4: 98,456,218 P20H probably damaging Het
Pcdhb12 T A 18: 37,437,048 W416R probably benign Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pola1 C A X: 93,461,472 R1313L probably benign Het
Ppp1r36 G A 12: 76,417,657 V10I probably benign Het
Rnf150 C T 8: 82,864,461 T151I probably benign Het
Tank G T 2: 61,643,786 probably null Het
Tmprss4 C T 9: 45,180,666 V174M probably benign Het
Trappc13 T C 13: 104,161,082 T105A probably damaging Het
Txndc9 G A 1: 37,994,050 Q84* probably null Het
Ubr3 A T 2: 70,016,130 probably null Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Zcchc6 A G 13: 59,782,024 S1066P probably damaging Het
Zfp51 A G 17: 21,463,440 K106E probably benign Het
Other mutations in Best2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01398:Best2 APN 8 85009327 missense probably damaging 0.99
R1165:Best2 UTSW 8 85011160 missense probably benign 0.06
R1446:Best2 UTSW 8 85007964 missense probably benign 0.01
R1715:Best2 UTSW 8 85011223 missense probably benign 0.41
R1928:Best2 UTSW 8 85011253 missense probably benign 0.13
R1944:Best2 UTSW 8 85010761 critical splice donor site probably null
R1951:Best2 UTSW 8 85011229 missense possibly damaging 0.46
R2006:Best2 UTSW 8 85013189 critical splice donor site probably null
R3691:Best2 UTSW 8 85011254 missense probably benign 0.01
R4693:Best2 UTSW 8 85011203 missense probably damaging 0.99
R6149:Best2 UTSW 8 85013267 missense probably benign 0.00
R6696:Best2 UTSW 8 85011244 nonsense probably null
R6857:Best2 UTSW 8 85007823 missense probably benign 0.06
R6983:Best2 UTSW 8 85009776 missense probably benign 0.01
R7008:Best2 UTSW 8 85013211 missense possibly damaging 0.88
R7266:Best2 UTSW 8 85007764 missense probably benign
R7417:Best2 UTSW 8 85009666 splice site probably null
R7782:Best2 UTSW 8 85009514 missense probably damaging 1.00
R8015:Best2 UTSW 8 85009354 missense not run
Predicted Primers PCR Primer
(F):5'- AAGTTGGTCTCAAAGTCGTCG -3'
(R):5'- CTCTGATGTTCAATGCCAGTAC -3'

Sequencing Primer
(F):5'- GGTCTCAAAGTCGTCGTCGTC -3'
(R):5'- AATGCCAGTACTGATCTTTCCAGGAC -3'
Posted On2015-04-17