Incidental Mutation 'R3918:Zcchc6'
ID307516
Institutional Source Beutler Lab
Gene Symbol Zcchc6
Ensembl Gene ENSMUSG00000035248
Gene Namezinc finger, CCHC domain containing 6
Synonyms6030448M23Rik
MMRRC Submission 040816-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.674) question?
Stock #R3918 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location59771561-59823147 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59782024 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1066 (S1066P)
Ref Sequence ENSEMBL: ENSMUSP00000153376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071703] [ENSMUST00000224480]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071703
AA Change: S1468P

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000071623
Gene: ENSMUSG00000035248
AA Change: S1468P

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
low complexity region 176 190 N/A INTRINSIC
ZnF_C2H2 244 268 2.61e1 SMART
SCOP:d1f5aa2 284 497 4e-25 SMART
low complexity region 522 534 N/A INTRINSIC
Pfam:PAP_assoc 550 603 6.7e-14 PFAM
low complexity region 811 825 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 882 898 N/A INTRINSIC
ZnF_C2HC 960 976 3.3e-3 SMART
Pfam:NTP_transf_2 1022 1134 4e-8 PFAM
Pfam:PAP_assoc 1229 1282 1.7e-17 PFAM
ZnF_C2HC 1342 1358 2.09e-3 SMART
Pfam:TUTF7_u4 1359 1446 1.6e-42 PFAM
ZnF_C2HC 1448 1464 1.06e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224320
Predicted Effect probably damaging
Transcript: ENSMUST00000224480
AA Change: S1066P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224845
Predicted Effect unknown
Transcript: ENSMUST00000225581
AA Change: S74P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226102
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T C 8: 111,040,142 I52T probably damaging Het
Adhfe1 G A 1: 9,576,216 R447H probably damaging Het
Ak7 A G 12: 105,710,256 K72E probably benign Het
Best2 T G 8: 85,009,724 D270A probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Col18a1 T C 10: 77,053,358 M1721V probably benign Het
Ctnnal1 T C 4: 56,865,000 T39A possibly damaging Het
Dnah9 T A 11: 65,870,974 M3897L possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Egf T C 3: 129,696,860 I395V probably null Het
Fbln5 C T 12: 101,750,791 G446D probably damaging Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Hmcn1 G C 1: 150,690,610 T2214S probably benign Het
Lef1 A G 3: 131,111,641 N57S probably damaging Het
Lpin1 A G 12: 16,571,189 S266P probably benign Het
Marveld2 T C 13: 100,611,893 Q226R probably benign Het
Mest G A 6: 30,742,750 S132N probably benign Het
Mras T A 9: 99,411,420 I56F probably damaging Het
Myh13 G A 11: 67,329,238 E138K probably benign Het
Nsun2 A G 13: 69,630,680 T516A probably damaging Het
Ola1 A G 2: 73,142,339 V200A probably benign Het
Olfr994 A T 2: 85,430,730 V33D possibly damaging Het
Patj C A 4: 98,456,218 P20H probably damaging Het
Pcdhb12 T A 18: 37,437,048 W416R probably benign Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pola1 C A X: 93,461,472 R1313L probably benign Het
Ppp1r36 G A 12: 76,417,657 V10I probably benign Het
Rnf150 C T 8: 82,864,461 T151I probably benign Het
Tank G T 2: 61,643,786 probably null Het
Tmprss4 C T 9: 45,180,666 V174M probably benign Het
Trappc13 T C 13: 104,161,082 T105A probably damaging Het
Txndc9 G A 1: 37,994,050 Q84* probably null Het
Ubr3 A T 2: 70,016,130 probably null Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Zfp51 A G 17: 21,463,440 K106E probably benign Het
Other mutations in Zcchc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Zcchc6 APN 13 59816698 missense probably damaging 1.00
IGL01361:Zcchc6 APN 13 59785800 missense probably damaging 1.00
IGL02002:Zcchc6 APN 13 59782096 missense possibly damaging 0.76
IGL02015:Zcchc6 APN 13 59789258 missense probably damaging 1.00
IGL02029:Zcchc6 APN 13 59784888 unclassified probably benign
IGL02216:Zcchc6 APN 13 59800423 missense probably benign 0.01
IGL02705:Zcchc6 APN 13 59789203 missense probably damaging 1.00
IGL02742:Zcchc6 APN 13 59816342 missense probably damaging 0.99
IGL02810:Zcchc6 APN 13 59782016 critical splice donor site probably null
IGL02942:Zcchc6 APN 13 59811521 missense probably damaging 0.98
IGL03104:Zcchc6 APN 13 59814903 missense probably benign 0.04
R0025:Zcchc6 UTSW 13 59805328 missense probably benign 0.08
R0025:Zcchc6 UTSW 13 59805328 missense probably benign 0.08
R0153:Zcchc6 UTSW 13 59782336 nonsense probably null
R0269:Zcchc6 UTSW 13 59816855 intron probably null
R0358:Zcchc6 UTSW 13 59782104 missense probably damaging 0.99
R0555:Zcchc6 UTSW 13 59800317 missense probably benign 0.00
R0599:Zcchc6 UTSW 13 59809487 missense probably damaging 1.00
R0609:Zcchc6 UTSW 13 59799782 nonsense probably null
R0617:Zcchc6 UTSW 13 59816855 intron probably null
R0680:Zcchc6 UTSW 13 59800599 missense possibly damaging 0.79
R0699:Zcchc6 UTSW 13 59782014 splice site probably benign
R1214:Zcchc6 UTSW 13 59805326 missense possibly damaging 0.76
R1271:Zcchc6 UTSW 13 59821855 missense probably damaging 0.99
R1556:Zcchc6 UTSW 13 59800240 missense probably benign 0.02
R1662:Zcchc6 UTSW 13 59799903 missense possibly damaging 0.93
R1777:Zcchc6 UTSW 13 59791821 missense probably damaging 1.00
R1834:Zcchc6 UTSW 13 59814935 nonsense probably null
R1928:Zcchc6 UTSW 13 59816734 missense probably damaging 1.00
R2012:Zcchc6 UTSW 13 59811538 missense probably damaging 0.99
R2045:Zcchc6 UTSW 13 59800656 missense probably damaging 1.00
R2336:Zcchc6 UTSW 13 59799054 missense probably damaging 1.00
R3764:Zcchc6 UTSW 13 59800380 missense probably damaging 0.98
R3899:Zcchc6 UTSW 13 59789255 nonsense probably null
R4423:Zcchc6 UTSW 13 59822049 missense probably damaging 0.96
R4664:Zcchc6 UTSW 13 59800599 missense possibly damaging 0.79
R4673:Zcchc6 UTSW 13 59796845 missense probably damaging 1.00
R4770:Zcchc6 UTSW 13 59772884 unclassified probably benign
R4884:Zcchc6 UTSW 13 59789452 missense probably damaging 1.00
R5186:Zcchc6 UTSW 13 59816656 critical splice donor site probably null
R5337:Zcchc6 UTSW 13 59791852 missense probably damaging 1.00
R5385:Zcchc6 UTSW 13 59789846 critical splice donor site probably null
R5452:Zcchc6 UTSW 13 59800657 missense probably damaging 1.00
R5534:Zcchc6 UTSW 13 59788553 missense probably damaging 1.00
R5566:Zcchc6 UTSW 13 59788629 nonsense probably null
R5928:Zcchc6 UTSW 13 59822066 missense probably benign 0.16
R5994:Zcchc6 UTSW 13 59789209 missense probably damaging 1.00
R6415:Zcchc6 UTSW 13 59816296 unclassified probably null
R6495:Zcchc6 UTSW 13 59799939 missense possibly damaging 0.95
R6577:Zcchc6 UTSW 13 59808161 missense probably damaging 1.00
R7205:Zcchc6 UTSW 13 59788550 missense probably damaging 1.00
R7286:Zcchc6 UTSW 13 59821649 missense probably benign 0.18
R7355:Zcchc6 UTSW 13 59821802 missense probably benign 0.00
R7369:Zcchc6 UTSW 13 59782053 missense possibly damaging 0.71
R7455:Zcchc6 UTSW 13 59822057 missense probably benign 0.03
R7557:Zcchc6 UTSW 13 59788466 missense possibly damaging 0.89
R7635:Zcchc6 UTSW 13 59800090 missense probably benign 0.03
R7727:Zcchc6 UTSW 13 59799682 missense probably benign 0.00
R7798:Zcchc6 UTSW 13 59815575 missense possibly damaging 0.81
R7912:Zcchc6 UTSW 13 59799005 missense probably damaging 1.00
R7993:Zcchc6 UTSW 13 59799005 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGAGAGGAGACTAGCATTC -3'
(R):5'- AAGAAGATAAGCTCACACCGTG -3'

Sequencing Primer
(F):5'- TTTCATAAGGCTACCTAGACCCAGG -3'
(R):5'- CGTGTGCAGCTGCGAAAG -3'
Posted On2015-04-17