Incidental Mutation 'R3918:Trappc13'
ID307519
Institutional Source Beutler Lab
Gene Symbol Trappc13
Ensembl Gene ENSMUSG00000021711
Gene Nametrafficking protein particle complex 13
Synonyms2410002O22Rik, 2610524F24Rik
MMRRC Submission 040816-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.837) question?
Stock #R3918 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location104142149-104178469 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104161082 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 105 (T105A)
Ref Sequence ENSEMBL: ENSMUSP00000136986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022224] [ENSMUST00000141557] [ENSMUST00000144060] [ENSMUST00000179891]
Predicted Effect probably damaging
Transcript: ENSMUST00000022224
AA Change: T105A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022224
Gene: ENSMUSG00000021711
AA Change: T105A

DomainStartEndE-ValueType
Pfam:DUF974 65 298 1.3e-87 PFAM
low complexity region 366 388 N/A INTRINSIC
low complexity region 405 418 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141557
AA Change: T105A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118316
Gene: ENSMUSG00000021711
AA Change: T105A

DomainStartEndE-ValueType
Pfam:DUF974 65 299 1.6e-88 PFAM
low complexity region 365 387 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000144060
AA Change: T105A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114406
Gene: ENSMUSG00000021711
AA Change: T105A

DomainStartEndE-ValueType
Pfam:DUF974 65 293 4.4e-87 PFAM
low complexity region 360 382 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179891
AA Change: T105A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136986
Gene: ENSMUSG00000021711
AA Change: T105A

DomainStartEndE-ValueType
Pfam:DUF974 65 299 1e-87 PFAM
low complexity region 366 388 N/A INTRINSIC
low complexity region 405 418 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T C 8: 111,040,142 I52T probably damaging Het
Adhfe1 G A 1: 9,576,216 R447H probably damaging Het
Ak7 A G 12: 105,710,256 K72E probably benign Het
Best2 T G 8: 85,009,724 D270A probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Col18a1 T C 10: 77,053,358 M1721V probably benign Het
Ctnnal1 T C 4: 56,865,000 T39A possibly damaging Het
Dnah9 T A 11: 65,870,974 M3897L possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Egf T C 3: 129,696,860 I395V probably null Het
Fbln5 C T 12: 101,750,791 G446D probably damaging Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Hmcn1 G C 1: 150,690,610 T2214S probably benign Het
Lef1 A G 3: 131,111,641 N57S probably damaging Het
Lpin1 A G 12: 16,571,189 S266P probably benign Het
Marveld2 T C 13: 100,611,893 Q226R probably benign Het
Mest G A 6: 30,742,750 S132N probably benign Het
Mras T A 9: 99,411,420 I56F probably damaging Het
Myh13 G A 11: 67,329,238 E138K probably benign Het
Nsun2 A G 13: 69,630,680 T516A probably damaging Het
Ola1 A G 2: 73,142,339 V200A probably benign Het
Olfr994 A T 2: 85,430,730 V33D possibly damaging Het
Patj C A 4: 98,456,218 P20H probably damaging Het
Pcdhb12 T A 18: 37,437,048 W416R probably benign Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pola1 C A X: 93,461,472 R1313L probably benign Het
Ppp1r36 G A 12: 76,417,657 V10I probably benign Het
Rnf150 C T 8: 82,864,461 T151I probably benign Het
Tank G T 2: 61,643,786 probably null Het
Tmprss4 C T 9: 45,180,666 V174M probably benign Het
Txndc9 G A 1: 37,994,050 Q84* probably null Het
Ubr3 A T 2: 70,016,130 probably null Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Zcchc6 A G 13: 59,782,024 S1066P probably damaging Het
Zfp51 A G 17: 21,463,440 K106E probably benign Het
Other mutations in Trappc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00826:Trappc13 APN 13 104144508 missense probably benign 0.30
IGL01930:Trappc13 APN 13 104148078 splice site probably benign
IGL02637:Trappc13 APN 13 104150062 missense probably benign 0.00
R0470:Trappc13 UTSW 13 104161004 missense possibly damaging 0.51
R0620:Trappc13 UTSW 13 104161081 missense probably damaging 1.00
R0628:Trappc13 UTSW 13 104154916 splice site probably benign
R1402:Trappc13 UTSW 13 104150116 missense probably damaging 1.00
R1402:Trappc13 UTSW 13 104150116 missense probably damaging 1.00
R1530:Trappc13 UTSW 13 104150143 missense probably damaging 1.00
R1826:Trappc13 UTSW 13 104169819 critical splice donor site probably null
R1951:Trappc13 UTSW 13 104174642 missense probably benign 0.43
R3755:Trappc13 UTSW 13 104168560 missense probably benign
R3756:Trappc13 UTSW 13 104168560 missense probably benign
R4704:Trappc13 UTSW 13 104166821 intron probably benign
R4916:Trappc13 UTSW 13 104154294 critical splice donor site probably null
R5590:Trappc13 UTSW 13 104148241 missense probably damaging 1.00
R5635:Trappc13 UTSW 13 104150098 missense probably benign 0.01
R6862:Trappc13 UTSW 13 104150152 missense probably damaging 1.00
R7708:Trappc13 UTSW 13 104147337 missense probably benign 0.06
R8049:Trappc13 UTSW 13 104144544 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAGACTTAAAGTGCCAGGGC -3'
(R):5'- GATTTTCATATGACACACCATTACCCC -3'

Sequencing Primer
(F):5'- CTTCAATATATTGCACATTCACGTG -3'
(R):5'- TATGACACACCATTACCCCTCATTAG -3'
Posted On2015-04-17