Incidental Mutation 'R3918:Zfp51'
ID307520
Institutional Source Beutler Lab
Gene Symbol Zfp51
Ensembl Gene ENSMUSG00000023892
Gene Namezinc finger protein 51
SynonymsZfp-51, zfec12
MMRRC Submission 040816-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R3918 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location21450374-21465587 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21463440 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 106 (K106E)
Ref Sequence ENSEMBL: ENSMUSP00000045684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039577]
Predicted Effect probably benign
Transcript: ENSMUST00000039577
AA Change: K106E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045684
Gene: ENSMUSG00000023892
AA Change: K106E

DomainStartEndE-ValueType
KRAB 43 103 1.71e-22 SMART
ZnF_C2H2 214 236 2.36e-2 SMART
ZnF_C2H2 242 264 8.94e-3 SMART
ZnF_C2H2 270 292 7.9e-4 SMART
ZnF_C2H2 298 320 3.44e-4 SMART
ZnF_C2H2 326 348 7.15e-2 SMART
ZnF_C2H2 354 376 4.54e-4 SMART
ZnF_C2H2 382 404 3.44e-4 SMART
ZnF_C2H2 410 432 9.88e-5 SMART
ZnF_C2H2 438 460 3.16e-3 SMART
ZnF_C2H2 466 488 1.58e-3 SMART
ZnF_C2H2 494 517 2.57e-3 SMART
ZnF_C2H2 523 545 3.63e-3 SMART
ZnF_C2H2 551 573 1.4e-4 SMART
ZnF_C2H2 579 601 4.17e-3 SMART
ZnF_C2H2 607 629 2.79e-4 SMART
ZnF_C2H2 635 657 4.24e-4 SMART
ZnF_C2H2 663 685 9.08e-4 SMART
ZnF_C2H2 691 713 8.47e-4 SMART
ZnF_C2H2 719 741 1.36e-2 SMART
ZnF_C2H2 747 769 6.82e1 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T C 8: 111,040,142 I52T probably damaging Het
Adhfe1 G A 1: 9,576,216 R447H probably damaging Het
Ak7 A G 12: 105,710,256 K72E probably benign Het
Best2 T G 8: 85,009,724 D270A probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Col18a1 T C 10: 77,053,358 M1721V probably benign Het
Ctnnal1 T C 4: 56,865,000 T39A possibly damaging Het
Dnah9 T A 11: 65,870,974 M3897L possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Egf T C 3: 129,696,860 I395V probably null Het
Fbln5 C T 12: 101,750,791 G446D probably damaging Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Hmcn1 G C 1: 150,690,610 T2214S probably benign Het
Lef1 A G 3: 131,111,641 N57S probably damaging Het
Lpin1 A G 12: 16,571,189 S266P probably benign Het
Marveld2 T C 13: 100,611,893 Q226R probably benign Het
Mest G A 6: 30,742,750 S132N probably benign Het
Mras T A 9: 99,411,420 I56F probably damaging Het
Myh13 G A 11: 67,329,238 E138K probably benign Het
Nsun2 A G 13: 69,630,680 T516A probably damaging Het
Ola1 A G 2: 73,142,339 V200A probably benign Het
Olfr994 A T 2: 85,430,730 V33D possibly damaging Het
Patj C A 4: 98,456,218 P20H probably damaging Het
Pcdhb12 T A 18: 37,437,048 W416R probably benign Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pola1 C A X: 93,461,472 R1313L probably benign Het
Ppp1r36 G A 12: 76,417,657 V10I probably benign Het
Rnf150 C T 8: 82,864,461 T151I probably benign Het
Tank G T 2: 61,643,786 probably null Het
Tmprss4 C T 9: 45,180,666 V174M probably benign Het
Trappc13 T C 13: 104,161,082 T105A probably damaging Het
Txndc9 G A 1: 37,994,050 Q84* probably null Het
Ubr3 A T 2: 70,016,130 probably null Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Zcchc6 A G 13: 59,782,024 S1066P probably damaging Het
Other mutations in Zfp51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Zfp51 APN 17 21463452 missense probably benign 0.11
IGL00971:Zfp51 APN 17 21463582 missense probably benign 0.03
IGL02002:Zfp51 APN 17 21463959 missense probably damaging 0.98
IGL02268:Zfp51 APN 17 21463419 nonsense probably null
IGL03249:Zfp51 APN 17 21463439 missense probably damaging 1.00
R1569:Zfp51 UTSW 17 21456380 missense probably benign 0.01
R1853:Zfp51 UTSW 17 21464323 missense probably damaging 1.00
R1989:Zfp51 UTSW 17 21456320 missense possibly damaging 0.90
R2285:Zfp51 UTSW 17 21463875 missense probably damaging 1.00
R2407:Zfp51 UTSW 17 21463831 missense probably damaging 0.98
R2890:Zfp51 UTSW 17 21463856 missense probably damaging 1.00
R4529:Zfp51 UTSW 17 21464736 missense probably damaging 1.00
R4587:Zfp51 UTSW 17 21464916 nonsense probably null
R4866:Zfp51 UTSW 17 21461750 missense possibly damaging 0.61
R4872:Zfp51 UTSW 17 21464671 missense probably benign 0.26
R4961:Zfp51 UTSW 17 21456353 missense probably benign 0.01
R5392:Zfp51 UTSW 17 21465322 missense possibly damaging 0.60
R5611:Zfp51 UTSW 17 21464092 missense probably damaging 1.00
R7109:Zfp51 UTSW 17 21463569 missense possibly damaging 0.80
R7129:Zfp51 UTSW 17 21461709 missense probably damaging 1.00
R7269:Zfp51 UTSW 17 21463698 missense probably benign 0.09
R7303:Zfp51 UTSW 17 21463796 missense probably benign 0.24
R7514:Zfp51 UTSW 17 21463500 missense probably benign 0.37
R7665:Zfp51 UTSW 17 21463581 missense probably benign 0.00
R8073:Zfp51 UTSW 17 21464032 missense probably damaging 1.00
R8177:Zfp51 UTSW 17 21463867 missense probably benign 0.05
X0062:Zfp51 UTSW 17 21464995 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACCCTTGAAAGCTGTCAGG -3'
(R):5'- ACTCACAAGGTTCTTCTCCAG -3'

Sequencing Primer
(F):5'- CCCTTGAAAGCTGTCAGGATATG -3'
(R):5'- ACAAGGTTCTTCTCCAGTATGCG -3'
Posted On2015-04-17