Incidental Mutation 'R3918:Pola1'
ID307522
Institutional Source Beutler Lab
Gene Symbol Pola1
Ensembl Gene ENSMUSG00000006678
Gene Namepolymerase (DNA directed), alpha 1
SynonymsPola
MMRRC Submission 040816-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R3918 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location93304767-93632155 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 93461472 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 1313 (R1313L)
Ref Sequence ENSEMBL: ENSMUSP00000006856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006856]
Predicted Effect probably benign
Transcript: ENSMUST00000006856
AA Change: R1313L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000006856
Gene: ENSMUSG00000006678
AA Change: R1313L

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
Pfam:DNA_pol_alpha_N 41 102 5.5e-22 PFAM
Blast:POLBc 136 508 1e-152 BLAST
POLBc 539 1016 2.07e-134 SMART
low complexity region 1051 1058 N/A INTRINSIC
Blast:POLBc 1098 1187 4e-47 BLAST
Pfam:zf-DNA_Pol 1269 1458 4.5e-52 PFAM
Meta Mutation Damage Score 0.3485 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of DNA polymerase, which together with a regulatory and two primase subunits, forms the DNA polymerase alpha complex. The catalytic subunit plays an essential role in the initiation of DNA replication. [provided by RefSeq, Mar 2010]
PHENOTYPE: Male chimeras hemizygous for a gene trapped allele appear normal at E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T C 8: 111,040,142 I52T probably damaging Het
Adhfe1 G A 1: 9,576,216 R447H probably damaging Het
Ak7 A G 12: 105,710,256 K72E probably benign Het
Best2 T G 8: 85,009,724 D270A probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Col18a1 T C 10: 77,053,358 M1721V probably benign Het
Ctnnal1 T C 4: 56,865,000 T39A possibly damaging Het
Dnah9 T A 11: 65,870,974 M3897L possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Egf T C 3: 129,696,860 I395V probably null Het
Fbln5 C T 12: 101,750,791 G446D probably damaging Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Hmcn1 G C 1: 150,690,610 T2214S probably benign Het
Lef1 A G 3: 131,111,641 N57S probably damaging Het
Lpin1 A G 12: 16,571,189 S266P probably benign Het
Marveld2 T C 13: 100,611,893 Q226R probably benign Het
Mest G A 6: 30,742,750 S132N probably benign Het
Mras T A 9: 99,411,420 I56F probably damaging Het
Myh13 G A 11: 67,329,238 E138K probably benign Het
Nsun2 A G 13: 69,630,680 T516A probably damaging Het
Ola1 A G 2: 73,142,339 V200A probably benign Het
Olfr994 A T 2: 85,430,730 V33D possibly damaging Het
Patj C A 4: 98,456,218 P20H probably damaging Het
Pcdhb12 T A 18: 37,437,048 W416R probably benign Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Ppp1r36 G A 12: 76,417,657 V10I probably benign Het
Rnf150 C T 8: 82,864,461 T151I probably benign Het
Tank G T 2: 61,643,786 probably null Het
Tmprss4 C T 9: 45,180,666 V174M probably benign Het
Trappc13 T C 13: 104,161,082 T105A probably damaging Het
Txndc9 G A 1: 37,994,050 Q84* probably null Het
Ubr3 A T 2: 70,016,130 probably null Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Zcchc6 A G 13: 59,782,024 S1066P probably damaging Het
Zfp51 A G 17: 21,463,440 K106E probably benign Het
Other mutations in Pola1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00469:Pola1 APN X 93594785 missense possibly damaging 0.62
IGL00469:Pola1 APN X 93561385 missense probably damaging 1.00
IGL00946:Pola1 APN X 93480539 missense probably benign 0.01
R0606:Pola1 UTSW X 93488087 splice site probably benign
R1955:Pola1 UTSW X 93597261 missense probably damaging 1.00
R3919:Pola1 UTSW X 93461472 missense probably benign 0.01
R4402:Pola1 UTSW X 93561423 missense probably damaging 0.99
Z1176:Pola1 UTSW X 93480604 missense not run
Predicted Primers PCR Primer
(F):5'- GAATTTCCTAAGTGTTCTCAACTGC -3'
(R):5'- GTAAGTCCTGTCTTACATGGGATG -3'

Sequencing Primer
(F):5'- AAGTGTTCTCAACTGCAATAAAAAC -3'
(R):5'- ACCACGTACTTCTAATTAGGGTC -3'
Posted On2015-04-17