Incidental Mutation 'R3943:Olfr845'
ID307544
Institutional Source Beutler Lab
Gene Symbol Olfr845
Ensembl Gene ENSMUSG00000061614
Gene Nameolfactory receptor 845
SynonymsOlfr1522-ps1, MOR150-2, MOR150-1P, GA_x6K02T2PVTD-13076685-13077623, MOR150-1P, MOR150-1
MMRRC Submission 040924-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R3943 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location19336457-19341718 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19339075 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 205 (M205K)
Ref Sequence ENSEMBL: ENSMUSP00000150474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071259] [ENSMUST00000213344] [ENSMUST00000215572]
Predicted Effect probably benign
Transcript: ENSMUST00000071259
AA Change: M205K

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000071239
Gene: ENSMUSG00000061614
AA Change: M205K

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.1e-56 PFAM
Pfam:7tm_1 41 290 2.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212246
AA Change: M205K
Predicted Effect probably benign
Transcript: ENSMUST00000213344
AA Change: M205K

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000215572
AA Change: M205K

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,269,524 L603* probably null Het
6030419C18Rik AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 9: 58,499,432 probably benign Het
Adnp A G 2: 168,185,060 I105T possibly damaging Het
Atf3 A G 1: 191,171,516 I171T possibly damaging Het
Atp6v0a1 A G 11: 101,055,517 I773V probably benign Het
Cad T A 5: 31,072,385 probably null Het
Camkv T A 9: 107,947,983 D366E possibly damaging Het
Dnah8 T A 17: 30,694,065 probably benign Het
Dock7 A G 4: 98,992,431 S932P probably damaging Het
Fam227a C T 15: 79,620,859 probably benign Het
Fbp2 A G 13: 62,841,793 F233S possibly damaging Het
Gm7534 T C 4: 134,200,345 T366A probably benign Het
Gnptab G T 10: 88,433,894 V820L probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gpr158 C A 2: 21,368,559 R102S possibly damaging Het
Gramd1b A T 9: 40,531,044 M1K probably null Het
H2-T23 A G 17: 36,030,643 V312A probably benign Het
Hltf A T 3: 20,092,744 I494F probably damaging Het
Il16 G A 7: 83,652,015 L300F probably damaging Het
Kcnq1 T C 7: 143,426,088 L657P probably damaging Het
Krt4 G A 15: 101,921,250 T281M probably benign Het
Mia3 A G 1: 183,358,783 F196S possibly damaging Het
Naip6 T C 13: 100,294,739 T1197A probably benign Het
Nrxn2 T A 19: 6,473,335 N204K probably damaging Het
Rassf6 G T 5: 90,604,326 Q258K possibly damaging Het
Rhpn1 T C 15: 75,711,806 L380P probably damaging Het
Ribc2 A G 15: 85,135,250 M78V probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skint5 T A 4: 113,942,753 H73L probably damaging Het
Smg6 G A 11: 74,929,541 G213R probably damaging Het
Sspn T A 6: 145,934,357 W62R probably damaging Het
Stard9 A G 2: 120,698,229 S1656G probably benign Het
Svep1 T A 4: 58,084,807 probably null Het
Tab1 T C 15: 80,153,740 L258P probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Trf T A 9: 103,222,952 I271F probably benign Het
Trpm7 A T 2: 126,831,218 N538K possibly damaging Het
Usp28 T A 9: 49,000,366 L25I probably benign Het
Vmn2r14 A T 5: 109,216,064 I662N probably damaging Het
Vmn2r42 A T 7: 8,194,780 F280Y possibly damaging Het
Vps8 A T 16: 21,470,123 N411Y probably damaging Het
Vwa2 T G 19: 56,909,315 L684R probably damaging Het
Zfp712 T C 13: 67,041,332 Q377R probably benign Het
Zfp947 C A 17: 22,145,820 G291V probably damaging Het
Other mutations in Olfr845
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Olfr845 APN 9 19338772 missense possibly damaging 0.56
IGL01637:Olfr845 APN 9 19338964 missense probably damaging 1.00
IGL01767:Olfr845 APN 9 19339302 missense possibly damaging 0.54
IGL01945:Olfr845 APN 9 19339332 missense probably damaging 0.98
IGL02202:Olfr845 APN 9 19339249 missense probably benign 0.06
IGL02877:Olfr845 APN 9 19339201 missense possibly damaging 0.86
R0466:Olfr845 UTSW 9 19339179 missense probably damaging 1.00
R1521:Olfr845 UTSW 9 19338652 missense probably benign 0.35
R1650:Olfr845 UTSW 9 19338647 missense possibly damaging 0.49
R1766:Olfr845 UTSW 9 19338858 missense probably benign 0.06
R2060:Olfr845 UTSW 9 19339056 missense probably benign 0.01
R2082:Olfr845 UTSW 9 19339278 missense probably benign 0.36
R2257:Olfr845 UTSW 9 19338493 missense probably benign 0.01
R2892:Olfr845 UTSW 9 19338738 missense probably benign 0.04
R3156:Olfr845 UTSW 9 19339424 unclassified probably null
R4116:Olfr845 UTSW 9 19338644 missense probably benign 0.39
R4518:Olfr845 UTSW 9 19339260 missense possibly damaging 0.86
R4814:Olfr845 UTSW 9 19339180 missense probably damaging 1.00
R5339:Olfr845 UTSW 9 19339159 missense possibly damaging 0.78
R6647:Olfr845 UTSW 9 19338629 missense possibly damaging 0.50
R7493:Olfr845 UTSW 9 19338813 missense probably damaging 0.98
R7522:Olfr845 UTSW 9 19338998 nonsense probably null
R7584:Olfr845 UTSW 9 19339273 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTTGCCACCCTCTGAGGTAC -3'
(R):5'- GAGCTAATGTACACTCCTAAGCC -3'

Sequencing Primer
(F):5'- CTCTGAGGTACACAGTCATCATG -3'
(R):5'- AATGTACACTCCTAAGCCTGTCC -3'
Posted On2015-04-17