Incidental Mutation 'R3943:Usp28'
ID307545
Institutional Source Beutler Lab
Gene Symbol Usp28
Ensembl Gene ENSMUSG00000032267
Gene Nameubiquitin specific peptidase 28
Synonyms9830148O20Rik
MMRRC Submission 040924-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3943 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location48985375-49042517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49000366 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 25 (L25I)
Ref Sequence ENSEMBL: ENSMUSP00000149207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047349] [ENSMUST00000213874] [ENSMUST00000215788]
Predicted Effect probably benign
Transcript: ENSMUST00000047349
AA Change: L25I

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000047467
Gene: ENSMUSG00000032267
AA Change: L25I

DomainStartEndE-ValueType
UIM 97 116 3.1e-3 SMART
Pfam:UCH 161 652 5.4e-52 PFAM
Pfam:UCH_1 162 626 2e-11 PFAM
low complexity region 695 705 N/A INTRINSIC
low complexity region 713 730 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213874
AA Change: L25I

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000215788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216607
Meta Mutation Damage Score 0.202 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a deubiquitinase involved in the DNA damage pathway and DNA damage-induced apoptosis. Overexpression of this gene is seen in several cancers. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit slightly decreased spleen weight and splenocyte number but show neither major signaling defects in DNA damage response nor developmental defects indicative of impaired double-strand break metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,269,524 L603* probably null Het
6030419C18Rik AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 9: 58,499,432 probably benign Het
Adnp A G 2: 168,185,060 I105T possibly damaging Het
Atf3 A G 1: 191,171,516 I171T possibly damaging Het
Atp6v0a1 A G 11: 101,055,517 I773V probably benign Het
Cad T A 5: 31,072,385 probably null Het
Camkv T A 9: 107,947,983 D366E possibly damaging Het
Dnah8 T A 17: 30,694,065 probably benign Het
Dock7 A G 4: 98,992,431 S932P probably damaging Het
Fam227a C T 15: 79,620,859 probably benign Het
Fbp2 A G 13: 62,841,793 F233S possibly damaging Het
Gm7534 T C 4: 134,200,345 T366A probably benign Het
Gnptab G T 10: 88,433,894 V820L probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gpr158 C A 2: 21,368,559 R102S possibly damaging Het
Gramd1b A T 9: 40,531,044 M1K probably null Het
H2-T23 A G 17: 36,030,643 V312A probably benign Het
Hltf A T 3: 20,092,744 I494F probably damaging Het
Il16 G A 7: 83,652,015 L300F probably damaging Het
Kcnq1 T C 7: 143,426,088 L657P probably damaging Het
Krt4 G A 15: 101,921,250 T281M probably benign Het
Mia3 A G 1: 183,358,783 F196S possibly damaging Het
Naip6 T C 13: 100,294,739 T1197A probably benign Het
Nrxn2 T A 19: 6,473,335 N204K probably damaging Het
Olfr845 T A 9: 19,339,075 M205K probably benign Het
Rassf6 G T 5: 90,604,326 Q258K possibly damaging Het
Rhpn1 T C 15: 75,711,806 L380P probably damaging Het
Ribc2 A G 15: 85,135,250 M78V probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skint5 T A 4: 113,942,753 H73L probably damaging Het
Smg6 G A 11: 74,929,541 G213R probably damaging Het
Sspn T A 6: 145,934,357 W62R probably damaging Het
Stard9 A G 2: 120,698,229 S1656G probably benign Het
Svep1 T A 4: 58,084,807 probably null Het
Tab1 T C 15: 80,153,740 L258P probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Trf T A 9: 103,222,952 I271F probably benign Het
Trpm7 A T 2: 126,831,218 N538K possibly damaging Het
Vmn2r14 A T 5: 109,216,064 I662N probably damaging Het
Vmn2r42 A T 7: 8,194,780 F280Y possibly damaging Het
Vps8 A T 16: 21,470,123 N411Y probably damaging Het
Vwa2 T G 19: 56,909,315 L684R probably damaging Het
Zfp712 T C 13: 67,041,332 Q377R probably benign Het
Zfp947 C A 17: 22,145,820 G291V probably damaging Het
Other mutations in Usp28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Usp28 APN 9 49028163 missense probably benign 0.01
IGL01105:Usp28 APN 9 49010250 missense probably damaging 1.00
IGL01124:Usp28 APN 9 49037213 missense probably damaging 1.00
IGL01304:Usp28 APN 9 49026819 missense probably damaging 0.99
IGL01527:Usp28 APN 9 49025873 missense probably benign 0.02
IGL01859:Usp28 APN 9 49024021 nonsense probably null
IGL01860:Usp28 APN 9 49032243 nonsense probably null
IGL02047:Usp28 APN 9 49035641 missense probably damaging 0.99
IGL02188:Usp28 APN 9 49024009 missense probably benign 0.00
IGL02267:Usp28 APN 9 49023965 missense probably damaging 1.00
IGL02472:Usp28 APN 9 49037769 missense possibly damaging 0.95
IGL02675:Usp28 APN 9 49039091 missense possibly damaging 0.81
IGL02982:Usp28 APN 9 49018439 missense probably benign 0.00
IGL03105:Usp28 APN 9 49039055 missense probably damaging 0.99
R0100:Usp28 UTSW 9 49035932 missense probably damaging 1.00
R0114:Usp28 UTSW 9 49039023 missense probably benign 0.00
R0196:Usp28 UTSW 9 49028278 missense probably damaging 0.96
R0206:Usp28 UTSW 9 49028269 missense probably damaging 1.00
R0349:Usp28 UTSW 9 49010281 nonsense probably null
R0379:Usp28 UTSW 9 49024067 missense possibly damaging 0.58
R0454:Usp28 UTSW 9 49039101 missense possibly damaging 0.94
R0479:Usp28 UTSW 9 49037213 missense probably damaging 1.00
R0540:Usp28 UTSW 9 49024060 missense probably benign
R0726:Usp28 UTSW 9 49003869 missense probably damaging 1.00
R0835:Usp28 UTSW 9 49001524 missense probably damaging 1.00
R0928:Usp28 UTSW 9 49030891 missense possibly damaging 0.60
R1271:Usp28 UTSW 9 49035961 critical splice donor site probably null
R1534:Usp28 UTSW 9 48985506 missense possibly damaging 0.92
R1539:Usp28 UTSW 9 49037796 missense probably benign 0.07
R1687:Usp28 UTSW 9 49024017 missense probably benign 0.00
R1867:Usp28 UTSW 9 49009194 missense probably benign 0.00
R1868:Usp28 UTSW 9 49016707 missense probably damaging 1.00
R1884:Usp28 UTSW 9 49035947 missense probably damaging 1.00
R2029:Usp28 UTSW 9 48985503 missense probably benign 0.22
R2046:Usp28 UTSW 9 49039075 missense probably damaging 1.00
R2379:Usp28 UTSW 9 49003095 missense probably null 0.94
R2404:Usp28 UTSW 9 49037258 critical splice donor site probably null
R3196:Usp28 UTSW 9 49025825 missense probably benign 0.03
R3831:Usp28 UTSW 9 49035638 missense probably benign 0.00
R3922:Usp28 UTSW 9 49030923 critical splice donor site probably null
R3924:Usp28 UTSW 9 49030923 critical splice donor site probably null
R3926:Usp28 UTSW 9 49030923 critical splice donor site probably null
R4834:Usp28 UTSW 9 49001536 missense probably damaging 1.00
R5041:Usp28 UTSW 9 49037773 missense probably benign
R5186:Usp28 UTSW 9 49010250 missense probably damaging 1.00
R5308:Usp28 UTSW 9 49037201 missense probably damaging 1.00
R5870:Usp28 UTSW 9 49025985 nonsense probably null
R6838:Usp28 UTSW 9 49000430 critical splice donor site probably null
R6959:Usp28 UTSW 9 49001542 missense probably damaging 1.00
R7058:Usp28 UTSW 9 49039156 missense probably damaging 1.00
R7348:Usp28 UTSW 9 49030877 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CCGGGCATTTTCAGTGTCTC -3'
(R):5'- TGCTGGGACTCCTAAAAGC -3'

Sequencing Primer
(F):5'- AGTGTCTCTGACCATCAGCAACTTG -3'
(R):5'- AACCACCTGACCTGTAGTTGG -3'
Posted On2015-04-17