Incidental Mutation 'R0376:Bcr'
Institutional Source Beutler Lab
Gene Symbol Bcr
Ensembl Gene ENSMUSG00000009681
Gene Namebreakpoint cluster region
MMRRC Submission 038582-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.925) question?
Stock #R0376 (G1)
Quality Score225
Status Validated
Chromosomal Location75060592-75184921 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 75145327 bp
Amino Acid Change Leucine to Phenylalanine at position 659 (L659F)
Ref Sequence ENSEMBL: ENSMUSP00000126377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164107]
Predicted Effect probably damaging
Transcript: ENSMUST00000164107
AA Change: L659F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126377
Gene: ENSMUSG00000009681
AA Change: L659F

Pfam:Bcr-Abl_Oligo 3 75 1.2e-44 PFAM
low complexity region 86 109 N/A INTRINSIC
low complexity region 121 147 N/A INTRINSIC
low complexity region 342 358 N/A INTRINSIC
low complexity region 371 389 N/A INTRINSIC
low complexity region 461 470 N/A INTRINSIC
RhoGEF 501 689 6.22e-51 SMART
PH 708 867 7.95e-8 SMART
C2 911 1016 2.85e-11 SMART
RhoGAP 1064 1248 6.42e-70 SMART
Meta Mutation Damage Score 0.8824 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.0%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A reciprocal translocation between chromosomes 22 and 9 produces the Philadelphia chromosome, which is often found in patients with chronic myelogenous leukemia. The chromosome 22 breakpoint for this translocation is located within the BCR gene. The translocation produces a fusion protein which is encoded by sequence from both BCR and ABL, the gene at the chromosome 9 breakpoint. Although the BCR-ABL fusion protein has been extensively studied, the function of the normal BCR gene product is not clear. The protein has serine/threonine kinase activity and is a GTPase-activating protein for p21rac. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are defective in hormonal and behavioral stress response regulation and prone to septic shock, whereas chimeric mice carrying a BCR-ABL fusion mutation mimicking human Philadelphia chromosome develop chronic myeloid leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik G A 2: 173,528,327 E132K probably benign Het
Adam6a T C 12: 113,544,690 Y228H probably damaging Het
Als2 A G 1: 59,215,565 F211S probably benign Het
Ankrd12 T A 17: 66,053,009 Q11L probably damaging Het
Anxa5 T C 3: 36,460,488 R115G probably damaging Het
Arhgap10 T C 8: 77,450,824 probably benign Het
Atp2a3 T A 11: 72,982,702 D782E probably damaging Het
Cacna1b A G 2: 24,659,003 probably benign Het
Camp C T 9: 109,848,399 C122Y probably damaging Het
Col12a1 A T 9: 79,693,494 S769R probably benign Het
Cyp2j6 T A 4: 96,526,023 K335I probably damaging Het
Cyp3a11 A C 5: 145,862,452 Y308* probably null Het
Flnb G A 14: 7,946,014 probably null Het
Frmd4a G T 2: 4,572,387 M351I probably damaging Het
Gabrg2 C T 11: 41,916,315 S365N possibly damaging Het
Ggn T C 7: 29,173,022 V609A possibly damaging Het
H60c T C 10: 3,260,435 probably benign Het
Hexdc T A 11: 121,218,165 probably benign Het
Igsf9b A G 9: 27,334,582 T1282A probably benign Het
Ikzf4 T C 10: 128,632,756 N618S probably benign Het
Ints14 A G 9: 64,983,990 K418E probably damaging Het
Iqgap1 T C 7: 80,723,879 E1454G probably benign Het
Kif13b T C 14: 64,757,404 probably benign Het
Krt71 A C 15: 101,738,070 F328C probably damaging Het
Lama2 T C 10: 27,015,546 T2524A possibly damaging Het
Mfn2 C T 4: 147,885,526 V363I probably benign Het
Mkln1 A T 6: 31,478,018 D496V probably benign Het
Olfr450 A T 6: 42,818,292 M274L probably benign Het
Patj T A 4: 98,568,987 I1242N probably damaging Het
Pcnx C T 12: 81,974,579 probably benign Het
Plcb2 T C 2: 118,717,240 E502G probably damaging Het
Plppr4 G T 3: 117,323,091 H314Q probably benign Het
Prkcsh A G 9: 22,010,251 probably benign Het
Prr14 C T 7: 127,476,643 H181Y probably benign Het
Pus3 A T 9: 35,566,422 M317L possibly damaging Het
Pwwp2a T A 11: 43,704,672 D221E probably benign Het
Rbm15 T C 3: 107,330,938 S715G probably benign Het
Rbm28 A G 6: 29,158,928 probably benign Het
Rhobtb2 A T 14: 69,796,735 V347E probably benign Het
Rimbp2 C T 5: 128,803,861 R161Q probably damaging Het
Scgb1b27 C T 7: 34,021,897 T70I possibly damaging Het
Slc40a1 T C 1: 45,912,491 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spaca9 A G 2: 28,693,660 V104A probably benign Het
Spag7 T C 11: 70,669,190 probably benign Het
Sugp1 A G 8: 70,052,638 D85G probably damaging Het
Sun1 A G 5: 139,226,699 probably benign Het
Tcp11l1 C A 2: 104,697,505 probably benign Het
Tead3 A C 17: 28,341,365 D88E probably damaging Het
Tecpr1 A T 5: 144,207,476 V636E possibly damaging Het
Tldc2 T C 2: 157,095,305 W147R probably damaging Het
Tmem161b A G 13: 84,292,383 T125A probably benign Het
Trrap A G 5: 144,816,339 M1825V probably benign Het
Ttbk2 A G 2: 120,777,581 F186L probably damaging Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Zc3h7a T C 16: 11,156,202 M240V probably benign Het
Zc3hc1 G C 6: 30,372,790 S351W probably damaging Het
Zfp366 T C 13: 99,234,251 M493T probably benign Het
Zfp93 C T 7: 24,275,861 P424S probably damaging Het
Other mutations in Bcr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Bcr APN 10 75157071 unclassified probably benign
IGL00662:Bcr APN 10 75168100 splice site probably benign
IGL01359:Bcr APN 10 75159779 unclassified probably benign
IGL01737:Bcr APN 10 75154951 missense probably damaging 0.99
IGL01908:Bcr APN 10 75061873 missense possibly damaging 0.85
IGL01954:Bcr APN 10 75175341 splice site probably null
IGL02169:Bcr APN 10 75159882 missense probably benign 0.07
IGL02379:Bcr APN 10 75157148 missense probably benign 0.02
IGL02380:Bcr APN 10 75175299 missense probably benign
IGL02385:Bcr APN 10 75145403 missense probably damaging 1.00
IGL02657:Bcr APN 10 75154964 missense probably benign 0.00
IGL02682:Bcr APN 10 75166046 missense possibly damaging 0.67
IGL02959:Bcr APN 10 75160390 missense probably benign 0.44
accrual UTSW 10 75061506 missense possibly damaging 0.77
Appreciation UTSW 10 75061125 nonsense probably null
R0329:Bcr UTSW 10 75181634 missense possibly damaging 0.88
R0330:Bcr UTSW 10 75181634 missense possibly damaging 0.88
R0685:Bcr UTSW 10 75131643 missense probably damaging 1.00
R0828:Bcr UTSW 10 75157207 unclassified probably benign
R0892:Bcr UTSW 10 75125063 missense probably benign 0.00
R1143:Bcr UTSW 10 75061365 missense probably benign 0.00
R1416:Bcr UTSW 10 75061506 missense possibly damaging 0.77
R1479:Bcr UTSW 10 75061125 nonsense probably null
R1611:Bcr UTSW 10 75125202 splice site probably null
R1636:Bcr UTSW 10 75131066 missense probably damaging 1.00
R1837:Bcr UTSW 10 75168100 splice site probably benign
R2341:Bcr UTSW 10 75131112 missense probably damaging 1.00
R2343:Bcr UTSW 10 75145422 missense probably benign 0.03
R3753:Bcr UTSW 10 75135940 missense probably benign 0.05
R4273:Bcr UTSW 10 75125111 missense probably damaging 0.97
R4624:Bcr UTSW 10 75153920 missense probably damaging 1.00
R4723:Bcr UTSW 10 75175329 missense probably benign 0.45
R5013:Bcr UTSW 10 75125066 missense probably benign 0.00
R5359:Bcr UTSW 10 75166085 missense probably damaging 0.99
R5458:Bcr UTSW 10 75154960 missense probably benign
R5982:Bcr UTSW 10 75176416 missense probably benign 0.08
R5988:Bcr UTSW 10 75175335 missense probably benign 0.01
R6220:Bcr UTSW 10 75062292 missense probably benign
R6827:Bcr UTSW 10 75131064 missense probably damaging 1.00
R6886:Bcr UTSW 10 75153937 missense probably damaging 1.00
R6990:Bcr UTSW 10 75131036 missense possibly damaging 0.80
R7003:Bcr UTSW 10 75061561 missense probably benign 0.08
R7424:Bcr UTSW 10 75157100 missense probably benign
R7443:Bcr UTSW 10 75143136 critical splice donor site probably null
R7488:Bcr UTSW 10 75160330 missense possibly damaging 0.80
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- agttgaaaatgaggatgttatggg -3'
Posted On2013-04-24