Incidental Mutation 'R3945:Nr2c2'
ID307641
Institutional Source Beutler Lab
Gene Symbol Nr2c2
Ensembl Gene ENSMUSG00000005893
Gene Namenuclear receptor subfamily 2, group C, member 2
SynonymsTAK1, Tr4
MMRRC Submission 040926-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.603) question?
Stock #R3945 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location92091390-92174294 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 92163138 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 464 (R464W)
Ref Sequence ENSEMBL: ENSMUSP00000138465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113460] [ENSMUST00000113463] [ENSMUST00000146175]
Predicted Effect probably damaging
Transcript: ENSMUST00000113460
AA Change: R464W

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109087
Gene: ENSMUSG00000005893
AA Change: R464W

DomainStartEndE-ValueType
ZnF_C4 114 185 4.33e-40 SMART
Blast:HOLI 238 324 4e-46 BLAST
HOLI 388 554 1.9e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113463
AA Change: R497W

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109090
Gene: ENSMUSG00000005893
AA Change: R497W

DomainStartEndE-ValueType
ZnF_C4 147 218 4.33e-40 SMART
Blast:HOLI 271 357 6e-46 BLAST
HOLI 421 587 1.9e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000146175
AA Change: R464W

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138465
Gene: ENSMUSG00000005893
AA Change: R464W

DomainStartEndE-ValueType
ZnF_C4 114 185 4.33e-40 SMART
Blast:HOLI 238 324 7e-47 BLAST
Pfam:Hormone_recep 367 493 8.8e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204497
Meta Mutation Damage Score 0.2279 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the nuclear hormone receptor family. Members of this family act as ligand-activated transcription factors and function in many biological processes such as development, cellular differentiation and homeostasis. The activated receptor/ligand complex is translocated to the nucleus where it binds to hormone response elements of target genes. The protein encoded by this gene plays a role in protecting cells from oxidative stress and damage induced by ionizing radiation. The lack of a similar gene in mouse results in growth retardation, severe spinal curvature, subfertility, premature aging, and prostatic intraepithelial neoplasia (PIN) development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous null mice display reduced body size, reduced male fertility, and impaired spermatogenesis. Mice homozygous for a conditional allele activated in the CNS exhibit increased thermal, mechanical and chemical nociception threshold, decreased pruritus and neuronal loss in the spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,289,964 I2229T probably damaging Het
4930407I10Rik T C 15: 82,065,400 L1166P probably damaging Het
Actn4 T C 7: 28,912,236 probably null Het
Adamts17 A T 7: 67,120,939 E905V probably benign Het
Adck5 A G 15: 76,595,200 N485S probably damaging Het
Agr3 C A 12: 35,947,513 probably benign Het
Ankrd12 G A 17: 65,976,103 T1921I probably damaging Het
Ascl2 T C 7: 142,967,971 S247G probably benign Het
Atp7b T C 8: 22,020,864 E422G probably benign Het
C630050I24Rik C T 8: 107,119,262 R15* probably null Het
Cabin1 T G 10: 75,745,259 Q411P probably damaging Het
Chrne T C 11: 70,617,043 I277V possibly damaging Het
Coch A G 12: 51,601,812 probably null Het
Corin A G 5: 72,358,424 V429A probably damaging Het
Cpa3 A T 3: 20,225,117 N219K probably damaging Het
Creb3l1 T C 2: 91,991,211 E273G probably damaging Het
Csmd1 A C 8: 15,910,619 probably null Het
Ddx59 A G 1: 136,434,618 D527G probably damaging Het
Defa25 G A 8: 21,084,490 V17I probably null Het
Efs A G 14: 54,920,651 probably benign Het
Ern2 A G 7: 122,176,530 M447T probably benign Het
Fgfr2 C T 7: 130,177,755 E596K possibly damaging Het
Filip1 T C 9: 79,818,367 K990R probably benign Het
Ipo8 T A 6: 148,818,117 Q110L probably damaging Het
Kank4 T A 4: 98,771,280 I854F probably damaging Het
Mst1 G A 9: 108,084,853 C681Y probably damaging Het
Olfr1289 C T 2: 111,483,687 Q86* probably null Het
Olfr1496 A G 19: 13,781,422 E270G probably benign Het
Pde11a T C 2: 76,075,931 probably benign Het
Ptprq A G 10: 107,686,392 probably benign Het
Rcbtb1 G A 14: 59,224,776 probably null Het
Rpl37 G A 15: 5,117,694 R72H probably benign Het
Samd9l A T 6: 3,377,029 S77R possibly damaging Het
Sin3b A G 8: 72,733,439 D218G possibly damaging Het
Slc22a23 A G 13: 34,183,126 I633T probably damaging Het
Spen T C 4: 141,477,353 D1321G unknown Het
Ssh2 T C 11: 77,454,668 S1160P possibly damaging Het
Synrg T A 11: 84,023,406 D952E probably damaging Het
Tigd3 A G 19: 5,892,433 F223S probably damaging Het
Trim66 G A 7: 109,472,268 T608I possibly damaging Het
Trmt13 A G 3: 116,581,518 F447S probably damaging Het
Trpc2 T C 7: 102,088,279 I800T possibly damaging Het
Ugt3a2 A T 15: 9,370,098 I443F possibly damaging Het
Vamp2 C A 11: 69,089,174 P24Q unknown Het
Vmn1r113 A G 7: 20,787,712 Y143C probably benign Het
Vmn1r14 T A 6: 57,234,269 N277K probably benign Het
Vmn1r181 T A 7: 23,984,152 V14E probably damaging Het
Wdfy4 A T 14: 32,966,395 I3086N probably damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Nr2c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Nr2c2 APN 6 92149719 missense probably damaging 1.00
IGL01129:Nr2c2 APN 6 92158416 missense probably benign 0.08
IGL01578:Nr2c2 APN 6 92162038 missense probably benign 0.01
IGL02281:Nr2c2 APN 6 92154514 missense probably benign 0.20
R1385:Nr2c2 UTSW 6 92154470 missense probably damaging 1.00
R1397:Nr2c2 UTSW 6 92149764 missense probably benign 0.34
R1503:Nr2c2 UTSW 6 92105331 missense probably benign
R1691:Nr2c2 UTSW 6 92156692 missense probably damaging 0.99
R1779:Nr2c2 UTSW 6 92159243 missense possibly damaging 0.50
R2655:Nr2c2 UTSW 6 92163138 missense probably damaging 0.99
R3840:Nr2c2 UTSW 6 92163138 missense probably damaging 0.99
R3841:Nr2c2 UTSW 6 92163138 missense probably damaging 0.99
R3923:Nr2c2 UTSW 6 92160401 missense probably damaging 0.98
R3926:Nr2c2 UTSW 6 92160401 missense probably damaging 0.98
R3946:Nr2c2 UTSW 6 92163138 missense probably damaging 0.99
R4721:Nr2c2 UTSW 6 92139847 missense possibly damaging 0.49
R5038:Nr2c2 UTSW 6 92139822 missense probably damaging 1.00
R5101:Nr2c2 UTSW 6 92154516 critical splice donor site probably null
R5524:Nr2c2 UTSW 6 92139765 splice site probably null
R6884:Nr2c2 UTSW 6 92158393 missense probably benign 0.05
R7046:Nr2c2 UTSW 6 92158357 missense probably damaging 1.00
R7278:Nr2c2 UTSW 6 92159378 missense probably damaging 0.96
R7316:Nr2c2 UTSW 6 92154463 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGGAAATGCAGCCCTTG -3'
(R):5'- TCCCCAGGAACATTTCTTTAGGG -3'

Sequencing Primer
(F):5'- GCCCTTGACAAGCTTGAAATG -3'
(R):5'- AGGGCTTTCCTACACAACTGATG -3'
Posted On2015-04-17