Incidental Mutation 'R3945:Adamts17'
ID307646
Institutional Source Beutler Lab
Gene Symbol Adamts17
Ensembl Gene ENSMUSG00000058145
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 17
SynonymsAU023434
MMRRC Submission 040926-MU
Accession Numbers

Genbank: NM_001033877; MGI: 3588195

Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R3945 (G1)
Quality Score169
Status Validated
Chromosome7
Chromosomal Location66839735-67153171 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67120939 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 905 (E905V)
Ref Sequence ENSEMBL: ENSMUSP00000103102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098382] [ENSMUST00000107478]
Predicted Effect probably benign
Transcript: ENSMUST00000098382
AA Change: E932V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095984
Gene: ENSMUSG00000058145
AA Change: E932V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Pep_M12B_propep 35 179 2.9e-25 PFAM
Pfam:Reprolysin_5 228 422 3.1e-15 PFAM
Pfam:Reprolysin_2 248 440 6.1e-13 PFAM
Pfam:Reprolysin_3 252 398 2.2e-12 PFAM
Pfam:Reprolysin_4 328 446 7.1e-10 PFAM
Pfam:Reprolysin 334 450 2e-18 PFAM
Blast:ACR 454 533 3e-12 BLAST
TSP1 544 596 2.2e-15 SMART
Pfam:ADAM_spacer1 698 808 6.4e-30 PFAM
TSP1 829 887 1.81e-1 SMART
TSP1 889 942 1.15e-4 SMART
TSP1 949 993 4.05e-5 SMART
TSP1 1000 1054 2.91e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107478
AA Change: E905V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103102
Gene: ENSMUSG00000058145
AA Change: E905V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Pep_M12B_propep 34 180 3.1e-23 PFAM
Pfam:Reprolysin_5 228 424 3.2e-15 PFAM
Pfam:Reprolysin_2 248 440 5.9e-11 PFAM
Pfam:Reprolysin_3 252 398 6e-12 PFAM
Pfam:Reprolysin_4 328 446 6.8e-10 PFAM
Pfam:Reprolysin 334 450 4.3e-21 PFAM
Blast:ACR 454 533 3e-12 BLAST
TSP1 544 596 2.2e-15 SMART
Pfam:ADAM_spacer1 700 781 2.2e-16 PFAM
TSP1 802 860 1.81e-1 SMART
TSP1 862 915 1.15e-4 SMART
TSP1 922 966 4.05e-5 SMART
TSP1 973 1027 2.91e-6 SMART
Pfam:PLAC 1046 1080 1.1e-10 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protein, which may promote breast cancer cell growth and survival. Mutations in this gene are associated with a Weill-Marchesani-like syndrome, which is characterized by lenticular myopia, ectopia lentis, glaucoma, spherophakia, and short stature. [provided by RefSeq, May 2016]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,289,964 I2229T probably damaging Het
4930407I10Rik T C 15: 82,065,400 L1166P probably damaging Het
Actn4 T C 7: 28,912,236 probably null Het
Adck5 A G 15: 76,595,200 N485S probably damaging Het
Agr3 C A 12: 35,947,513 probably benign Het
Ankrd12 G A 17: 65,976,103 T1921I probably damaging Het
Ascl2 T C 7: 142,967,971 S247G probably benign Het
Atp7b T C 8: 22,020,864 E422G probably benign Het
C630050I24Rik C T 8: 107,119,262 R15* probably null Het
Cabin1 T G 10: 75,745,259 Q411P probably damaging Het
Chrne T C 11: 70,617,043 I277V possibly damaging Het
Coch A G 12: 51,601,812 probably null Het
Corin A G 5: 72,358,424 V429A probably damaging Het
Cpa3 A T 3: 20,225,117 N219K probably damaging Het
Creb3l1 T C 2: 91,991,211 E273G probably damaging Het
Csmd1 A C 8: 15,910,619 probably null Het
Ddx59 A G 1: 136,434,618 D527G probably damaging Het
Defa25 G A 8: 21,084,490 V17I probably null Het
Efs A G 14: 54,920,651 probably benign Het
Ern2 A G 7: 122,176,530 M447T probably benign Het
Fgfr2 C T 7: 130,177,755 E596K possibly damaging Het
Filip1 T C 9: 79,818,367 K990R probably benign Het
Ipo8 T A 6: 148,818,117 Q110L probably damaging Het
Kank4 T A 4: 98,771,280 I854F probably damaging Het
Mst1 G A 9: 108,084,853 C681Y probably damaging Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr1289 C T 2: 111,483,687 Q86* probably null Het
Olfr1496 A G 19: 13,781,422 E270G probably benign Het
Pde11a T C 2: 76,075,931 probably benign Het
Ptprq A G 10: 107,686,392 probably benign Het
Rcbtb1 G A 14: 59,224,776 probably null Het
Rpl37 G A 15: 5,117,694 R72H probably benign Het
Samd9l A T 6: 3,377,029 S77R possibly damaging Het
Sin3b A G 8: 72,733,439 D218G possibly damaging Het
Slc22a23 A G 13: 34,183,126 I633T probably damaging Het
Spen T C 4: 141,477,353 D1321G unknown Het
Ssh2 T C 11: 77,454,668 S1160P possibly damaging Het
Synrg T A 11: 84,023,406 D952E probably damaging Het
Tigd3 A G 19: 5,892,433 F223S probably damaging Het
Trim66 G A 7: 109,472,268 T608I possibly damaging Het
Trmt13 A G 3: 116,581,518 F447S probably damaging Het
Trpc2 T C 7: 102,088,279 I800T possibly damaging Het
Ugt3a2 A T 15: 9,370,098 I443F possibly damaging Het
Vamp2 C A 11: 69,089,174 P24Q unknown Het
Vmn1r113 A G 7: 20,787,712 Y143C probably benign Het
Vmn1r14 T A 6: 57,234,269 N277K probably benign Het
Vmn1r181 T A 7: 23,984,152 V14E probably damaging Het
Wdfy4 A T 14: 32,966,395 I3086N probably damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Adamts17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Adamts17 APN 7 66968902 missense probably damaging 1.00
IGL00950:Adamts17 APN 7 67120912 missense possibly damaging 0.69
IGL01532:Adamts17 APN 7 66908601 missense probably damaging 1.00
IGL01591:Adamts17 APN 7 67004396 missense probably damaging 1.00
IGL01602:Adamts17 APN 7 66888411 missense probably benign 0.29
IGL01640:Adamts17 APN 7 67029680 missense probably damaging 0.98
IGL01686:Adamts17 APN 7 66840289 missense probably benign 0.06
IGL01747:Adamts17 APN 7 67052011 missense probably damaging 1.00
IGL02081:Adamts17 APN 7 67062110 missense probably damaging 1.00
IGL02152:Adamts17 APN 7 67125000 missense probably benign 0.01
IGL02264:Adamts17 APN 7 67047459 splice site probably null
IGL02457:Adamts17 APN 7 67027814 missense probably damaging 0.99
IGL02519:Adamts17 APN 7 67124973 missense possibly damaging 0.82
IGL02530:Adamts17 APN 7 66909376 missense probably damaging 1.00
IGL02649:Adamts17 APN 7 66849878 splice site probably benign
IGL02711:Adamts17 APN 7 67052040 splice site probably benign
IGL03006:Adamts17 APN 7 67078347 missense possibly damaging 0.53
IGL03203:Adamts17 APN 7 67062108 missense probably damaging 1.00
IGL03343:Adamts17 APN 7 67075316 missense probably damaging 1.00
E2594:Adamts17 UTSW 7 67004350 missense probably damaging 1.00
R0380:Adamts17 UTSW 7 67150044 missense probably benign 0.00
R0416:Adamts17 UTSW 7 66915898 splice site probably null
R0635:Adamts17 UTSW 7 66908605 missense probably damaging 1.00
R1083:Adamts17 UTSW 7 67147574 missense probably damaging 1.00
R1476:Adamts17 UTSW 7 67075343 missense probably damaging 1.00
R1728:Adamts17 UTSW 7 67149956 nonsense probably null
R1729:Adamts17 UTSW 7 67149956 nonsense probably null
R1763:Adamts17 UTSW 7 67147715 missense probably damaging 1.00
R1784:Adamts17 UTSW 7 67149956 nonsense probably null
R1905:Adamts17 UTSW 7 67047472 nonsense probably null
R1938:Adamts17 UTSW 7 67125072 missense probably damaging 1.00
R3106:Adamts17 UTSW 7 67125072 missense probably damaging 1.00
R3796:Adamts17 UTSW 7 66839914 splice site probably null
R3849:Adamts17 UTSW 7 66840467 missense possibly damaging 0.92
R3850:Adamts17 UTSW 7 66840467 missense possibly damaging 0.92
R4519:Adamts17 UTSW 7 66840566 missense probably damaging 0.99
R4554:Adamts17 UTSW 7 67027893 missense probably damaging 1.00
R4555:Adamts17 UTSW 7 67027893 missense probably damaging 1.00
R4556:Adamts17 UTSW 7 67027893 missense probably damaging 1.00
R4557:Adamts17 UTSW 7 67027893 missense probably damaging 1.00
R4700:Adamts17 UTSW 7 67041888 missense probably damaging 1.00
R4752:Adamts17 UTSW 7 67004470 missense probably damaging 0.96
R5019:Adamts17 UTSW 7 67062070 nonsense probably null
R5438:Adamts17 UTSW 7 66888417 missense probably benign 0.30
R5444:Adamts17 UTSW 7 67041899 missense probably benign 0.02
R5673:Adamts17 UTSW 7 67041807 missense probably damaging 1.00
R6326:Adamts17 UTSW 7 67120888 missense probably benign 0.05
R6964:Adamts17 UTSW 7 66909400 missense possibly damaging 0.93
R6964:Adamts17 UTSW 7 67004353 missense probably benign 0.00
R7129:Adamts17 UTSW 7 67121010 missense probably damaging 1.00
R7317:Adamts17 UTSW 7 66840556 nonsense probably null
R7355:Adamts17 UTSW 7 67075304 missense
R7386:Adamts17 UTSW 7 66968849 missense probably benign 0.25
R7407:Adamts17 UTSW 7 67047556 nonsense probably null
R7432:Adamts17 UTSW 7 67051917 missense
R7782:Adamts17 UTSW 7 67125054 missense probably damaging 1.00
R7817:Adamts17 UTSW 7 66909476 missense probably damaging 0.99
X0022:Adamts17 UTSW 7 67041901 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GGCCATTCTCTGTTTGAAGCTC -3'
(R):5'- TATCCTGGAGGTGACAGCACAC -3'

Sequencing Primer
(F):5'- TCTCCAGAGTTGATGACAAAGTTCCC -3'
(R):5'- TGACAGCACACCGTGGG -3'
Posted On2015-04-17