Mutagenetix > Incidental Mutations

Incidental Mutation 'R3945:Trim66'

307648

Institutional Source

Beutler Lab

Gene Symbol

Trim66

Ensembl Gene

ENSMUSG00000031026

Gene Name

tripartite motif-containing 66

Synonyms

Tif1d, D7H11orf29

MMRRC Submission

040926-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.183) question?

Stock #

R3945 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

109449006-109508134 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 109472268 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 608 (T608I)

Ref Sequence

ENSEMBL: ENSMUSP00000102350 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033339] [ENSMUST00000106739] [ENSMUST00000106741]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000033339
AA Change: T608I

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000033339
Gene: ENSMUSG00000031026
AA Change: T608I

Domain	Start	End	E-Value	Type
PHD	4	69	7.77e0	SMART
BBC	108	234	1.61e-39	SMART
low complexity region	318	333	N/A	INTRINSIC
low complexity region	452	486	N/A	INTRINSIC
low complexity region	517	530	N/A	INTRINSIC
low complexity region	568	581	N/A	INTRINSIC
PHD	998	1041	4.09e-10	SMART
BROMO	1069	1175	8.22e-27	SMART
low complexity region	1185	1199	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106739
AA Change: T608I

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000102350
Gene: ENSMUSG00000031026
AA Change: T608I

Domain	Start	End	E-Value	Type
PHD	4	69	7.77e0	SMART
BBC	108	234	1.61e-39	SMART
low complexity region	318	333	N/A	INTRINSIC
low complexity region	452	486	N/A	INTRINSIC
low complexity region	517	530	N/A	INTRINSIC
low complexity region	568	581	N/A	INTRINSIC
PHD	998	1041	4.09e-10	SMART
BROMO	1069	1175	8.22e-27	SMART
low complexity region	1185	1199	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106741
AA Change: T710I

PolyPhen 2 Score 0.628 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000102352
Gene: ENSMUSG00000031026
AA Change: T710I

Domain	Start	End	E-Value	Type
RING	28	78	2.38e-2	SMART
BBOX	102	140	1.48e0	SMART
PHD	106	171	7.77e0	SMART
RING	107	170	4.38e0	SMART
BBOX	162	203	4.21e-3	SMART
BBC	210	336	1.61e-39	SMART
low complexity region	420	435	N/A	INTRINSIC
low complexity region	554	588	N/A	INTRINSIC
low complexity region	619	632	N/A	INTRINSIC
low complexity region	670	683	N/A	INTRINSIC
PHD	1100	1143	4.09e-10	SMART
BROMO	1171	1277	8.22e-27	SMART
low complexity region	1287	1301	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137704

Meta Mutation Damage Score

0.0724

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

100% (54/54)

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	C	11: 78,289,964	I2229T	probably damaging	Het
4930407I10Rik	T	C	15: 82,065,400	L1166P	probably damaging	Het
Actn4	T	C	7: 28,912,236		probably null	Het
Adamts17	A	T	7: 67,120,939	E905V	probably benign	Het
Adck5	A	G	15: 76,595,200	N485S	probably damaging	Het
Agr3	C	A	12: 35,947,513		probably benign	Het
Ankrd12	G	A	17: 65,976,103	T1921I	probably damaging	Het
Ascl2	T	C	7: 142,967,971	S247G	probably benign	Het
Atp7b	T	C	8: 22,020,864	E422G	probably benign	Het
C630050I24Rik	C	T	8: 107,119,262	R15*	probably null	Het
Cabin1	T	G	10: 75,745,259	Q411P	probably damaging	Het
Chrne	T	C	11: 70,617,043	I277V	possibly damaging	Het
Coch	A	G	12: 51,601,812		probably null	Het
Corin	A	G	5: 72,358,424	V429A	probably damaging	Het
Cpa3	A	T	3: 20,225,117	N219K	probably damaging	Het
Creb3l1	T	C	2: 91,991,211	E273G	probably damaging	Het
Csmd1	A	C	8: 15,910,619		probably null	Het
Ddx59	A	G	1: 136,434,618	D527G	probably damaging	Het
Defa25	G	A	8: 21,084,490	V17I	probably null	Het
Efs	A	G	14: 54,920,651		probably benign	Het
Ern2	A	G	7: 122,176,530	M447T	probably benign	Het
Fgfr2	C	T	7: 130,177,755	E596K	possibly damaging	Het
Filip1	T	C	9: 79,818,367	K990R	probably benign	Het
Ipo8	T	A	6: 148,818,117	Q110L	probably damaging	Het
Kank4	T	A	4: 98,771,280	I854F	probably damaging	Het
Mst1	G	A	9: 108,084,853	C681Y	probably damaging	Het
Nr2c2	C	T	6: 92,163,138	R464W	probably damaging	Het
Olfr1289	C	T	2: 111,483,687	Q86*	probably null	Het
Olfr1496	A	G	19: 13,781,422	E270G	probably benign	Het
Pde11a	T	C	2: 76,075,931		probably benign	Het
Ptprq	A	G	10: 107,686,392		probably benign	Het
Rcbtb1	G	A	14: 59,224,776		probably null	Het
Rpl37	G	A	15: 5,117,694	R72H	probably benign	Het
Samd9l	A	T	6: 3,377,029	S77R	possibly damaging	Het
Sin3b	A	G	8: 72,733,439	D218G	possibly damaging	Het
Slc22a23	A	G	13: 34,183,126	I633T	probably damaging	Het
Spen	T	C	4: 141,477,353	D1321G	unknown	Het
Ssh2	T	C	11: 77,454,668	S1160P	possibly damaging	Het
Synrg	T	A	11: 84,023,406	D952E	probably damaging	Het
Tigd3	A	G	19: 5,892,433	F223S	probably damaging	Het
Trmt13	A	G	3: 116,581,518	F447S	probably damaging	Het
Trpc2	T	C	7: 102,088,279	I800T	possibly damaging	Het
Ugt3a2	A	T	15: 9,370,098	I443F	possibly damaging	Het
Vamp2	C	A	11: 69,089,174	P24Q	unknown	Het
Vmn1r113	A	G	7: 20,787,712	Y143C	probably benign	Het
Vmn1r14	T	A	6: 57,234,269	N277K	probably benign	Het
Vmn1r181	T	A	7: 23,984,152	V14E	probably damaging	Het
Wdfy4	A	T	14: 32,966,395	I3086N	probably damaging	Het
Zfp988	A	C	4: 147,332,785	K559Q	probably benign	Het

Other mutations in Trim66

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01539:Trim66	APN	7	109455066	missense	probably benign	0.02
IGL01758:Trim66	APN	7	109486045	critical splice donor site	probably null
IGL01982:Trim66	APN	7	109458763	missense	probably benign	0.00
IGL01983:Trim66	APN	7	109458251	nonsense	probably null
IGL02149:Trim66	APN	7	109460902	missense	possibly damaging	0.66
IGL02392:Trim66	APN	7	109460274	missense	probably benign	0.01
IGL02483:Trim66	APN	7	109477630	splice site	probably benign
IGL02832:Trim66	APN	7	109460497	missense	probably damaging	1.00
IGL02945:Trim66	APN	7	109460176	nonsense	probably null
IGL03085:Trim66	APN	7	109458745	missense	probably benign	0.17
PIT1430001:Trim66	UTSW	7	109475247	missense	probably damaging	0.99
R0326:Trim66	UTSW	7	109460172	missense	probably benign	0.00
R0358:Trim66	UTSW	7	109460176	nonsense	probably null
R0401:Trim66	UTSW	7	109475264	missense	probably damaging	0.98
R0470:Trim66	UTSW	7	109457542	splice site	probably benign
R0568:Trim66	UTSW	7	109460695	missense	probably benign	0.00
R0669:Trim66	UTSW	7	109454992	intron	probably benign
R0980:Trim66	UTSW	7	109455670	missense	probably damaging	1.00
R1015:Trim66	UTSW	7	109455233	missense	probably damaging	1.00
R1078:Trim66	UTSW	7	109472319	missense	probably damaging	1.00
R1099:Trim66	UTSW	7	109475454	missense	probably benign	0.34
R1181:Trim66	UTSW	7	109484577	critical splice donor site	probably null
R1497:Trim66	UTSW	7	109484619	missense	probably benign	0.00
R1583:Trim66	UTSW	7	109455080	missense	probably damaging	1.00
R1843:Trim66	UTSW	7	109475839	missense	probably damaging	0.99
R1998:Trim66	UTSW	7	109484577	critical splice donor site	probably null
R2016:Trim66	UTSW	7	109472232	critical splice donor site	probably null
R2143:Trim66	UTSW	7	109475113	missense	probably damaging	0.98
R2144:Trim66	UTSW	7	109475113	missense	probably damaging	0.98
R2145:Trim66	UTSW	7	109475113	missense	probably damaging	0.98
R4012:Trim66	UTSW	7	109458131	missense	probably damaging	0.98
R4464:Trim66	UTSW	7	109477690	missense	possibly damaging	0.51
R4473:Trim66	UTSW	7	109481995	missense	probably damaging	1.00
R4729:Trim66	UTSW	7	109456060	critical splice donor site	probably null
R4730:Trim66	UTSW	7	109483069	missense	probably damaging	1.00
R4775:Trim66	UTSW	7	109457589	nonsense	probably null
R4819:Trim66	UTSW	7	109457586	missense	probably damaging	1.00
R5269:Trim66	UTSW	7	109457590	missense	probably benign	0.00
R5557:Trim66	UTSW	7	109483737	missense	probably benign	0.06
R5832:Trim66	UTSW	7	109455202	missense	probably damaging	1.00
R6220:Trim66	UTSW	7	109483093	missense	probably damaging	0.97
R6243:Trim66	UTSW	7	109460274	missense	probably benign	0.01
R6374:Trim66	UTSW	7	109486062	missense	probably benign
R6450:Trim66	UTSW	7	109460738	missense	probably benign	0.09
R6543:Trim66	UTSW	7	109475879	missense	probably benign	0.01
R6788:Trim66	UTSW	7	109477754	missense	probably damaging	1.00
R6842:Trim66	UTSW	7	109460776	missense	probably benign	0.00
R7169:Trim66	UTSW	7	109455121	missense	probably benign	0.25
R7257:Trim66	UTSW	7	109460244	missense	probably damaging	1.00
R7328:Trim66	UTSW	7	109457751	missense	probably damaging	0.99
R7616:Trim66	UTSW	7	109483749	missense	probably damaging	0.99
RF013:Trim66	UTSW	7	109460753	missense	probably damaging	0.99
RF024:Trim66	UTSW	7	109460740	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- CACTCTAAATGAAGCCCAGTGAG -3'
(R):5'- TGGTATGCTCTCTGGGGAAAC -3'

Sequencing Primer
(F):5'- TGAAGCCCAGTGAGCCCATATG -3'
(R):5'- AAGCCAGCTCTACCTGTT -3'

Posted On

2015-04-17