Incidental Mutation 'R3945:Trim66'
ID307648
Institutional Source Beutler Lab
Gene Symbol Trim66
Ensembl Gene ENSMUSG00000031026
Gene Nametripartite motif-containing 66
SynonymsTif1d, D7H11orf29
MMRRC Submission 040926-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R3945 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location109449006-109508134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 109472268 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 608 (T608I)
Ref Sequence ENSEMBL: ENSMUSP00000102350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033339] [ENSMUST00000106739] [ENSMUST00000106741]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033339
AA Change: T608I

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000033339
Gene: ENSMUSG00000031026
AA Change: T608I

DomainStartEndE-ValueType
PHD 4 69 7.77e0 SMART
BBC 108 234 1.61e-39 SMART
low complexity region 318 333 N/A INTRINSIC
low complexity region 452 486 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 568 581 N/A INTRINSIC
PHD 998 1041 4.09e-10 SMART
BROMO 1069 1175 8.22e-27 SMART
low complexity region 1185 1199 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106739
AA Change: T608I

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102350
Gene: ENSMUSG00000031026
AA Change: T608I

DomainStartEndE-ValueType
PHD 4 69 7.77e0 SMART
BBC 108 234 1.61e-39 SMART
low complexity region 318 333 N/A INTRINSIC
low complexity region 452 486 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 568 581 N/A INTRINSIC
PHD 998 1041 4.09e-10 SMART
BROMO 1069 1175 8.22e-27 SMART
low complexity region 1185 1199 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106741
AA Change: T710I

PolyPhen 2 Score 0.628 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102352
Gene: ENSMUSG00000031026
AA Change: T710I

DomainStartEndE-ValueType
RING 28 78 2.38e-2 SMART
BBOX 102 140 1.48e0 SMART
PHD 106 171 7.77e0 SMART
RING 107 170 4.38e0 SMART
BBOX 162 203 4.21e-3 SMART
BBC 210 336 1.61e-39 SMART
low complexity region 420 435 N/A INTRINSIC
low complexity region 554 588 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
low complexity region 670 683 N/A INTRINSIC
PHD 1100 1143 4.09e-10 SMART
BROMO 1171 1277 8.22e-27 SMART
low complexity region 1287 1301 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137704
Meta Mutation Damage Score 0.0724 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,289,964 I2229T probably damaging Het
4930407I10Rik T C 15: 82,065,400 L1166P probably damaging Het
Actn4 T C 7: 28,912,236 probably null Het
Adamts17 A T 7: 67,120,939 E905V probably benign Het
Adck5 A G 15: 76,595,200 N485S probably damaging Het
Agr3 C A 12: 35,947,513 probably benign Het
Ankrd12 G A 17: 65,976,103 T1921I probably damaging Het
Ascl2 T C 7: 142,967,971 S247G probably benign Het
Atp7b T C 8: 22,020,864 E422G probably benign Het
C630050I24Rik C T 8: 107,119,262 R15* probably null Het
Cabin1 T G 10: 75,745,259 Q411P probably damaging Het
Chrne T C 11: 70,617,043 I277V possibly damaging Het
Coch A G 12: 51,601,812 probably null Het
Corin A G 5: 72,358,424 V429A probably damaging Het
Cpa3 A T 3: 20,225,117 N219K probably damaging Het
Creb3l1 T C 2: 91,991,211 E273G probably damaging Het
Csmd1 A C 8: 15,910,619 probably null Het
Ddx59 A G 1: 136,434,618 D527G probably damaging Het
Defa25 G A 8: 21,084,490 V17I probably null Het
Efs A G 14: 54,920,651 probably benign Het
Ern2 A G 7: 122,176,530 M447T probably benign Het
Fgfr2 C T 7: 130,177,755 E596K possibly damaging Het
Filip1 T C 9: 79,818,367 K990R probably benign Het
Ipo8 T A 6: 148,818,117 Q110L probably damaging Het
Kank4 T A 4: 98,771,280 I854F probably damaging Het
Mst1 G A 9: 108,084,853 C681Y probably damaging Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr1289 C T 2: 111,483,687 Q86* probably null Het
Olfr1496 A G 19: 13,781,422 E270G probably benign Het
Pde11a T C 2: 76,075,931 probably benign Het
Ptprq A G 10: 107,686,392 probably benign Het
Rcbtb1 G A 14: 59,224,776 probably null Het
Rpl37 G A 15: 5,117,694 R72H probably benign Het
Samd9l A T 6: 3,377,029 S77R possibly damaging Het
Sin3b A G 8: 72,733,439 D218G possibly damaging Het
Slc22a23 A G 13: 34,183,126 I633T probably damaging Het
Spen T C 4: 141,477,353 D1321G unknown Het
Ssh2 T C 11: 77,454,668 S1160P possibly damaging Het
Synrg T A 11: 84,023,406 D952E probably damaging Het
Tigd3 A G 19: 5,892,433 F223S probably damaging Het
Trmt13 A G 3: 116,581,518 F447S probably damaging Het
Trpc2 T C 7: 102,088,279 I800T possibly damaging Het
Ugt3a2 A T 15: 9,370,098 I443F possibly damaging Het
Vamp2 C A 11: 69,089,174 P24Q unknown Het
Vmn1r113 A G 7: 20,787,712 Y143C probably benign Het
Vmn1r14 T A 6: 57,234,269 N277K probably benign Het
Vmn1r181 T A 7: 23,984,152 V14E probably damaging Het
Wdfy4 A T 14: 32,966,395 I3086N probably damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Trim66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01539:Trim66 APN 7 109455066 missense probably benign 0.02
IGL01758:Trim66 APN 7 109486045 critical splice donor site probably null
IGL01982:Trim66 APN 7 109458763 missense probably benign 0.00
IGL01983:Trim66 APN 7 109458251 nonsense probably null
IGL02149:Trim66 APN 7 109460902 missense possibly damaging 0.66
IGL02392:Trim66 APN 7 109460274 missense probably benign 0.01
IGL02483:Trim66 APN 7 109477630 splice site probably benign
IGL02832:Trim66 APN 7 109460497 missense probably damaging 1.00
IGL02945:Trim66 APN 7 109460176 nonsense probably null
IGL03085:Trim66 APN 7 109458745 missense probably benign 0.17
PIT1430001:Trim66 UTSW 7 109475247 missense probably damaging 0.99
R0326:Trim66 UTSW 7 109460172 missense probably benign 0.00
R0358:Trim66 UTSW 7 109460176 nonsense probably null
R0401:Trim66 UTSW 7 109475264 missense probably damaging 0.98
R0470:Trim66 UTSW 7 109457542 splice site probably benign
R0568:Trim66 UTSW 7 109460695 missense probably benign 0.00
R0669:Trim66 UTSW 7 109454992 intron probably benign
R0980:Trim66 UTSW 7 109455670 missense probably damaging 1.00
R1015:Trim66 UTSW 7 109455233 missense probably damaging 1.00
R1078:Trim66 UTSW 7 109472319 missense probably damaging 1.00
R1099:Trim66 UTSW 7 109475454 missense probably benign 0.34
R1181:Trim66 UTSW 7 109484577 critical splice donor site probably null
R1497:Trim66 UTSW 7 109484619 missense probably benign 0.00
R1583:Trim66 UTSW 7 109455080 missense probably damaging 1.00
R1843:Trim66 UTSW 7 109475839 missense probably damaging 0.99
R1998:Trim66 UTSW 7 109484577 critical splice donor site probably null
R2016:Trim66 UTSW 7 109472232 critical splice donor site probably null
R2143:Trim66 UTSW 7 109475113 missense probably damaging 0.98
R2144:Trim66 UTSW 7 109475113 missense probably damaging 0.98
R2145:Trim66 UTSW 7 109475113 missense probably damaging 0.98
R4012:Trim66 UTSW 7 109458131 missense probably damaging 0.98
R4464:Trim66 UTSW 7 109477690 missense possibly damaging 0.51
R4473:Trim66 UTSW 7 109481995 missense probably damaging 1.00
R4729:Trim66 UTSW 7 109456060 critical splice donor site probably null
R4730:Trim66 UTSW 7 109483069 missense probably damaging 1.00
R4775:Trim66 UTSW 7 109457589 nonsense probably null
R4819:Trim66 UTSW 7 109457586 missense probably damaging 1.00
R5269:Trim66 UTSW 7 109457590 missense probably benign 0.00
R5557:Trim66 UTSW 7 109483737 missense probably benign 0.06
R5832:Trim66 UTSW 7 109455202 missense probably damaging 1.00
R6220:Trim66 UTSW 7 109483093 missense probably damaging 0.97
R6243:Trim66 UTSW 7 109460274 missense probably benign 0.01
R6374:Trim66 UTSW 7 109486062 missense probably benign
R6450:Trim66 UTSW 7 109460738 missense probably benign 0.09
R6543:Trim66 UTSW 7 109475879 missense probably benign 0.01
R6788:Trim66 UTSW 7 109477754 missense probably damaging 1.00
R6842:Trim66 UTSW 7 109460776 missense probably benign 0.00
R7169:Trim66 UTSW 7 109455121 missense probably benign 0.25
R7257:Trim66 UTSW 7 109460244 missense probably damaging 1.00
R7328:Trim66 UTSW 7 109457751 missense probably damaging 0.99
R7616:Trim66 UTSW 7 109483749 missense probably damaging 0.99
RF013:Trim66 UTSW 7 109460753 missense probably damaging 0.99
RF024:Trim66 UTSW 7 109460740 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CACTCTAAATGAAGCCCAGTGAG -3'
(R):5'- TGGTATGCTCTCTGGGGAAAC -3'

Sequencing Primer
(F):5'- TGAAGCCCAGTGAGCCCATATG -3'
(R):5'- AAGCCAGCTCTACCTGTT -3'
Posted On2015-04-17