Mutagenetix > Incidental Mutations

Incidental Mutation 'R3945:Ern2'

307649

Institutional Source

Beutler Lab

Gene Symbol

Ern2

Ensembl Gene

ENSMUSG00000030866

Gene Name

endoplasmic reticulum (ER) to nucleus signalling 2

Synonyms

Ire1b

MMRRC Submission

040926-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.090) question?

Stock #

R3945 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

122169893-122186207 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 122176530 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 447 (M447T)

Ref Sequence

ENSEMBL: ENSMUSP00000033153 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033153] [ENSMUST00000206198]

AlphaFold

Q9Z2E3

Predicted Effect

probably benign
Transcript: ENSMUST00000033153
AA Change: M447T

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000033153
Gene: ENSMUSG00000030866
AA Change: M447T

Domain	Start	End	E-Value	Type
low complexity region	14	28	N/A	INTRINSIC
PQQ	33	64	5.5e-8	SMART
PQQ	115	147	4.7e-4	SMART
PQQ	148	180	6.1e-2	SMART
PQQ	192	223	6.2e-3	SMART
low complexity region	449	461	N/A	INTRINSIC
S_TKc	508	768	2.5e-11	SMART
PUG	831	888	9e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000206198
AA Change: M447T

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

Meta Mutation Damage Score

0.0729

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

100% (54/54)

MGI Phenotype

PHENOTYPE: Mice homozygous for disruption of this gene are generally normal but display an increased susceptibility to intestinal inflammation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	C	11: 78,289,964	I2229T	probably damaging	Het
4930407I10Rik	T	C	15: 82,065,400	L1166P	probably damaging	Het
Actn4	T	C	7: 28,912,236		probably null	Het
Adamts17	A	T	7: 67,120,939	E905V	probably benign	Het
Adck5	A	G	15: 76,595,200	N485S	probably damaging	Het
Agr3	C	A	12: 35,947,513		probably benign	Het
Ankrd12	G	A	17: 65,976,103	T1921I	probably damaging	Het
Ascl2	T	C	7: 142,967,971	S247G	probably benign	Het
Atp7b	T	C	8: 22,020,864	E422G	probably benign	Het
C630050I24Rik	C	T	8: 107,119,262	R15*	probably null	Het
Cabin1	T	G	10: 75,745,259	Q411P	probably damaging	Het
Chrne	T	C	11: 70,617,043	I277V	possibly damaging	Het
Coch	A	G	12: 51,601,812		probably null	Het
Corin	A	G	5: 72,358,424	V429A	probably damaging	Het
Cpa3	A	T	3: 20,225,117	N219K	probably damaging	Het
Creb3l1	T	C	2: 91,991,211	E273G	probably damaging	Het
Csmd1	A	C	8: 15,910,619		probably null	Het
Ddx59	A	G	1: 136,434,618	D527G	probably damaging	Het
Defa25	G	A	8: 21,084,490	V17I	probably null	Het
Efs	A	G	14: 54,920,651		probably benign	Het
Fgfr2	C	T	7: 130,177,755	E596K	possibly damaging	Het
Filip1	T	C	9: 79,818,367	K990R	probably benign	Het
Ipo8	T	A	6: 148,818,117	Q110L	probably damaging	Het
Kank4	T	A	4: 98,771,280	I854F	probably damaging	Het
Mst1	G	A	9: 108,084,853	C681Y	probably damaging	Het
Nr2c2	C	T	6: 92,163,138	R464W	probably damaging	Het
Olfr1289	C	T	2: 111,483,687	Q86*	probably null	Het
Olfr1496	A	G	19: 13,781,422	E270G	probably benign	Het
Pde11a	T	C	2: 76,075,931		probably benign	Het
Ptprq	A	G	10: 107,686,392		probably benign	Het
Rcbtb1	G	A	14: 59,224,776		probably null	Het
Rpl37	G	A	15: 5,117,694	R72H	probably benign	Het
Samd9l	A	T	6: 3,377,029	S77R	possibly damaging	Het
Sin3b	A	G	8: 72,733,439	D218G	possibly damaging	Het
Slc22a23	A	G	13: 34,183,126	I633T	probably damaging	Het
Spen	T	C	4: 141,477,353	D1321G	unknown	Het
Ssh2	T	C	11: 77,454,668	S1160P	possibly damaging	Het
Synrg	T	A	11: 84,023,406	D952E	probably damaging	Het
Tigd3	A	G	19: 5,892,433	F223S	probably damaging	Het
Trim66	G	A	7: 109,472,268	T608I	possibly damaging	Het
Trmt13	A	G	3: 116,581,518	F447S	probably damaging	Het
Trpc2	T	C	7: 102,088,279	I800T	possibly damaging	Het
Ugt3a2	A	T	15: 9,370,098	I443F	possibly damaging	Het
Vamp2	C	A	11: 69,089,174	P24Q	unknown	Het
Vmn1r113	A	G	7: 20,787,712	Y143C	probably benign	Het
Vmn1r14	T	A	6: 57,234,269	N277K	probably benign	Het
Vmn1r181	T	A	7: 23,984,152	V14E	probably damaging	Het
Wdfy4	A	T	14: 32,966,395	I3086N	probably damaging	Het
Zfp988	A	C	4: 147,332,785	K559Q	probably benign	Het

Other mutations in Ern2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01060:Ern2	APN	7	122170092	missense	probably damaging	0.99
IGL01324:Ern2	APN	7	122183190	missense	possibly damaging	0.88
IGL02185:Ern2	APN	7	122173375	splice site	probably benign
IGL02738:Ern2	APN	7	122182899	missense	probably damaging	0.99
IGL02750:Ern2	APN	7	122181406	splice site	probably benign
IGL03247:Ern2	APN	7	122171671	missense	probably benign	0.02
ernie	UTSW	7	122171661	critical splice donor site	probably null
Ernie2	UTSW	7	122180862	splice site	probably benign
ernie3	UTSW	7	122173819	critical splice acceptor site	probably null
R0165:Ern2	UTSW	7	122179779	missense	probably benign	0.02
R0785:Ern2	UTSW	7	122171661	critical splice donor site	probably null
R0801:Ern2	UTSW	7	122180862	splice site	probably benign
R1345:Ern2	UTSW	7	122177770	missense	probably damaging	1.00
R1649:Ern2	UTSW	7	122177400	missense	probably damaging	1.00
R1747:Ern2	UTSW	7	122173819	critical splice acceptor site	probably null
R1747:Ern2	UTSW	7	122173820	critical splice acceptor site	probably null
R1846:Ern2	UTSW	7	122176536	missense	probably benign	0.32
R1899:Ern2	UTSW	7	122183842	splice site	probably benign
R1986:Ern2	UTSW	7	122171529	missense	probably benign	0.06
R2055:Ern2	UTSW	7	122183945	missense	possibly damaging	0.84
R2329:Ern2	UTSW	7	122173487	missense	possibly damaging	0.82
R2351:Ern2	UTSW	7	122171508	missense	probably damaging	0.97
R2894:Ern2	UTSW	7	122181587	missense	possibly damaging	0.94
R3176:Ern2	UTSW	7	122180964	missense	possibly damaging	0.89
R3276:Ern2	UTSW	7	122180964	missense	possibly damaging	0.89
R4303:Ern2	UTSW	7	122177846	critical splice acceptor site	probably null
R4874:Ern2	UTSW	7	122176587	missense	probably benign	0.28
R4943:Ern2	UTSW	7	122173258	missense	possibly damaging	0.95
R5184:Ern2	UTSW	7	122179959	missense	probably benign	0.03
R5629:Ern2	UTSW	7	122170166	missense	probably damaging	1.00
R5770:Ern2	UTSW	7	122179907	missense	possibly damaging	0.92
R6255:Ern2	UTSW	7	122173272	missense	probably damaging	1.00
R6272:Ern2	UTSW	7	122176646	missense	probably benign	0.05
R6277:Ern2	UTSW	7	122186107	missense	probably benign
R6624:Ern2	UTSW	7	122177783	missense	probably benign	0.00
R6940:Ern2	UTSW	7	122186146	missense	probably benign	0.01
R7491:Ern2	UTSW	7	122170533	missense	probably damaging	1.00
R7544:Ern2	UTSW	7	122173199	missense	probably benign	0.06
R7555:Ern2	UTSW	7	122170241	missense	probably damaging	1.00
R7843:Ern2	UTSW	7	122173708	missense	probably damaging	1.00
R8281:Ern2	UTSW	7	122170260	missense	probably damaging	1.00
R8321:Ern2	UTSW	7	122173208	missense	probably damaging	1.00
R8377:Ern2	UTSW	7	122181292	nonsense	probably null
R8548:Ern2	UTSW	7	122177839	missense	probably damaging	1.00
R8853:Ern2	UTSW	7	122173744	missense	probably damaging	1.00
R8929:Ern2	UTSW	7	122170140	missense	probably benign	0.03
R8931:Ern2	UTSW	7	122170140	missense	probably benign	0.03
R9088:Ern2	UTSW	7	122173667	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGCATCCTGTGAGAGGTCAG -3'
(R):5'- GGAGGAAGCTTTCACCACAAG -3'

Sequencing Primer
(F):5'- TTAGTGGGTGCCAGCCTTCC -3'
(R):5'- CAAGTGAAACCTGCTTTGTTCCTAG -3'

Posted On

2015-04-17