Incidental Mutation 'R3945:Tigd3'
ID307678
Institutional Source Beutler Lab
Gene Symbol Tigd3
Ensembl Gene ENSMUSG00000044390
Gene Nametigger transposable element derived 3
Synonyms
MMRRC Submission 040926-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.800) question?
Stock #R3945 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location5891139-5894107 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5892433 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 223 (F223S)
Ref Sequence ENSEMBL: ENSMUSP00000059302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055911] [ENSMUST00000118623] [ENSMUST00000136983]
Predicted Effect probably benign
Transcript: ENSMUST00000025746
SMART Domains Protein: ENSMUSP00000025746
Gene: ENSMUSG00000024826

DomainStartEndE-ValueType
Pfam:Requiem_N 1 40 1.4e-19 PFAM
low complexity region 115 131 N/A INTRINSIC
low complexity region 134 152 N/A INTRINSIC
ZnF_C2H2 165 188 4.47e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000055911
AA Change: F223S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000059302
Gene: ENSMUSG00000044390
AA Change: F223S

DomainStartEndE-ValueType
Pfam:CENP-B_N 6 59 2.5e-15 PFAM
CENPB 73 137 2.96e-7 SMART
Pfam:DDE_1 192 360 7.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118623
SMART Domains Protein: ENSMUSP00000113465
Gene: ENSMUSG00000024826

DomainStartEndE-ValueType
Pfam:Requiem_N 13 84 7.9e-40 PFAM
low complexity region 159 175 N/A INTRINSIC
low complexity region 178 196 N/A INTRINSIC
PDB:3IUF|A 203 263 1e-21 PDB
PHD 286 342 8.64e-9 SMART
RING 287 341 3.83e0 SMART
PHD 343 389 8.9e-11 SMART
RING 344 388 9.75e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136983
SMART Domains Protein: ENSMUSP00000120125
Gene: ENSMUSG00000024826

DomainStartEndE-ValueType
Pfam:Requiem_N 12 85 6.2e-41 PFAM
low complexity region 159 175 N/A INTRINSIC
low complexity region 178 196 N/A INTRINSIC
ZnF_C2H2 209 232 4.47e-3 SMART
PHD 272 328 8.64e-9 SMART
RING 273 327 3.83e0 SMART
PHD 329 375 8.9e-11 SMART
RING 330 374 9.75e-1 SMART
Meta Mutation Damage Score 0.5861 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tigger subfamily of the pogo superfamily of DNA-mediated transposons in humans. These proteins are related to DNA transposons found in fungi and nematodes, and more distantly to the Tc1 and mariner transposases. They are also very similar to the major mammalian centromere protein B. The exact function of this gene is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,289,964 I2229T probably damaging Het
4930407I10Rik T C 15: 82,065,400 L1166P probably damaging Het
Actn4 T C 7: 28,912,236 probably null Het
Adamts17 A T 7: 67,120,939 E905V probably benign Het
Adck5 A G 15: 76,595,200 N485S probably damaging Het
Agr3 C A 12: 35,947,513 probably benign Het
Ankrd12 G A 17: 65,976,103 T1921I probably damaging Het
Ascl2 T C 7: 142,967,971 S247G probably benign Het
Atp7b T C 8: 22,020,864 E422G probably benign Het
C630050I24Rik C T 8: 107,119,262 R15* probably null Het
Cabin1 T G 10: 75,745,259 Q411P probably damaging Het
Chrne T C 11: 70,617,043 I277V possibly damaging Het
Coch A G 12: 51,601,812 probably null Het
Corin A G 5: 72,358,424 V429A probably damaging Het
Cpa3 A T 3: 20,225,117 N219K probably damaging Het
Creb3l1 T C 2: 91,991,211 E273G probably damaging Het
Csmd1 A C 8: 15,910,619 probably null Het
Ddx59 A G 1: 136,434,618 D527G probably damaging Het
Defa25 G A 8: 21,084,490 V17I probably null Het
Efs A G 14: 54,920,651 probably benign Het
Ern2 A G 7: 122,176,530 M447T probably benign Het
Fgfr2 C T 7: 130,177,755 E596K possibly damaging Het
Filip1 T C 9: 79,818,367 K990R probably benign Het
Ipo8 T A 6: 148,818,117 Q110L probably damaging Het
Kank4 T A 4: 98,771,280 I854F probably damaging Het
Mst1 G A 9: 108,084,853 C681Y probably damaging Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr1289 C T 2: 111,483,687 Q86* probably null Het
Olfr1496 A G 19: 13,781,422 E270G probably benign Het
Pde11a T C 2: 76,075,931 probably benign Het
Ptprq A G 10: 107,686,392 probably benign Het
Rcbtb1 G A 14: 59,224,776 probably null Het
Rpl37 G A 15: 5,117,694 R72H probably benign Het
Samd9l A T 6: 3,377,029 S77R possibly damaging Het
Sin3b A G 8: 72,733,439 D218G possibly damaging Het
Slc22a23 A G 13: 34,183,126 I633T probably damaging Het
Spen T C 4: 141,477,353 D1321G unknown Het
Ssh2 T C 11: 77,454,668 S1160P possibly damaging Het
Synrg T A 11: 84,023,406 D952E probably damaging Het
Trim66 G A 7: 109,472,268 T608I possibly damaging Het
Trmt13 A G 3: 116,581,518 F447S probably damaging Het
Trpc2 T C 7: 102,088,279 I800T possibly damaging Het
Ugt3a2 A T 15: 9,370,098 I443F possibly damaging Het
Vamp2 C A 11: 69,089,174 P24Q unknown Het
Vmn1r113 A G 7: 20,787,712 Y143C probably benign Het
Vmn1r14 T A 6: 57,234,269 N277K probably benign Het
Vmn1r181 T A 7: 23,984,152 V14E probably damaging Het
Wdfy4 A T 14: 32,966,395 I3086N probably damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Tigd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0456:Tigd3 UTSW 19 5892793 missense probably damaging 1.00
R0699:Tigd3 UTSW 19 5891946 missense probably benign
R1416:Tigd3 UTSW 19 5891725 missense probably benign
R5945:Tigd3 UTSW 19 5891866 missense probably benign
R6253:Tigd3 UTSW 19 5892842 missense probably damaging 1.00
R7189:Tigd3 UTSW 19 5893022 missense probably benign 0.09
R7956:Tigd3 UTSW 19 5892566 missense possibly damaging 0.88
R8976:Tigd3 UTSW 19 5891825 missense probably benign 0.00
R8979:Tigd3 UTSW 19 5891825 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCGAACGTGATGGAGTCCAG -3'
(R):5'- AACAATGTGGGCTTTGGGAC -3'

Sequencing Primer
(F):5'- AGGAAGGCTGGCCCATTC -3'
(R):5'- TTTGGGACTCGCCAGGTC -3'
Posted On2015-04-17