Incidental Mutation 'R3946:Abi2'
ID307681
Institutional Source Beutler Lab
Gene Symbol Abi2
Ensembl Gene ENSMUSG00000026782
Gene Nameabl-interactor 2
Synonyms8430425M24Rik
MMRRC Submission 040827-MU
Accession Numbers

Genbank: NM_001198570.1, NM_001198571.1, NM_198127.2; Ensembl: ENSMUST00000052332, ENSMUST00000087417

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3946 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location60409619-60481158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60453754 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 328 (Q328R)
Ref Sequence ENSEMBL: ENSMUSP00000058754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052332] [ENSMUST00000185788] [ENSMUST00000186097] [ENSMUST00000187709] [ENSMUST00000188594] [ENSMUST00000188618] [ENSMUST00000189980] [ENSMUST00000190158]
Predicted Effect probably damaging
Transcript: ENSMUST00000052332
AA Change: Q328R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058754
Gene: ENSMUSG00000026782
AA Change: Q328R

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 168 1.1e-37 PFAM
low complexity region 236 262 N/A INTRINSIC
low complexity region 335 370 N/A INTRINSIC
SH3 387 442 5.55e-24 SMART
Predicted Effect unknown
Transcript: ENSMUST00000185788
AA Change: Q242R
SMART Domains Protein: ENSMUSP00000139483
Gene: ENSMUSG00000026782
AA Change: Q242R

DomainStartEndE-ValueType
Pfam:Abi_HHR 1 67 4.4e-25 PFAM
low complexity region 68 81 N/A INTRINSIC
low complexity region 83 115 N/A INTRINSIC
low complexity region 119 137 N/A INTRINSIC
low complexity region 249 284 N/A INTRINSIC
SH3 301 356 3.4e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186097
AA Change: Q248R

PolyPhen 2 Score 0.242 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139501
Gene: ENSMUSG00000026782
AA Change: Q248R

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 95 121 N/A INTRINSIC
low complexity region 125 143 N/A INTRINSIC
low complexity region 284 319 N/A INTRINSIC
SH3 336 391 3.4e-26 SMART
Predicted Effect unknown
Transcript: ENSMUST00000187400
AA Change: Q133R
Predicted Effect probably benign
Transcript: ENSMUST00000187709
AA Change: Q328R

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000139867
Gene: ENSMUSG00000026782
AA Change: Q328R

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 165 1.8e-33 PFAM
low complexity region 166 179 N/A INTRINSIC
low complexity region 236 262 N/A INTRINSIC
low complexity region 364 399 N/A INTRINSIC
SH3 416 471 3.4e-26 SMART
Predicted Effect unknown
Transcript: ENSMUST00000188594
AA Change: Q340R
SMART Domains Protein: ENSMUSP00000140750
Gene: ENSMUSG00000026782
AA Change: Q340R

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 165 1.7e-33 PFAM
low complexity region 166 179 N/A INTRINSIC
low complexity region 181 213 N/A INTRINSIC
low complexity region 217 235 N/A INTRINSIC
low complexity region 347 382 N/A INTRINSIC
SH3 399 454 3.4e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188618
AA Change: Q395R

PolyPhen 2 Score 0.242 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140274
Gene: ENSMUSG00000026782
AA Change: Q395R

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 5.1e-37 PFAM
low complexity region 172 185 N/A INTRINSIC
low complexity region 242 268 N/A INTRINSIC
low complexity region 272 290 N/A INTRINSIC
low complexity region 402 437 N/A INTRINSIC
SH3 454 487 2.29e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189980
AA Change: Q362R

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141068
Gene: ENSMUSG00000026782
AA Change: Q362R

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 5e-37 PFAM
low complexity region 172 185 N/A INTRINSIC
low complexity region 242 268 N/A INTRINSIC
low complexity region 369 404 N/A INTRINSIC
SH3 421 476 5.55e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190158
AA Change: Q192R

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139743
Gene: ENSMUSG00000026782
AA Change: Q192R

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
low complexity region 33 65 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
PDB:4N78|F 88 196 5e-62 PDB
low complexity region 226 261 N/A INTRINSIC
SH3 278 333 3.4e-26 SMART
Meta Mutation Damage Score 0.1056 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 98% (60/61)
MGI Phenotype PHENOTYPE: Homozygous null mice display microphthalmia, abnormal lens development, abnormal corpus callosum, cerebral cortex, and hippocampus morphology, and impaired contextual conditioning. [provided by MGI curators]
Allele List at MGI

All alleles(30) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(27)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 T C 13: 64,309,098 I104V probably damaging Het
Agr3 C A 12: 35,947,513 probably benign Het
Brca2 T A 5: 150,536,704 S481R probably damaging Het
Cabin1 T G 10: 75,745,259 Q411P probably damaging Het
Calr3 A G 8: 72,443,620 Y22H probably damaging Het
Caprin1 T A 2: 103,796,766 I59F probably damaging Het
Cdk5rap1 T C 2: 154,348,716 T442A probably damaging Het
Chn2 T C 6: 54,269,426 probably benign Het
Cic C A 7: 25,272,346 R501S possibly damaging Het
Coch A G 12: 51,601,812 probably null Het
Defa25 G A 8: 21,084,490 V17I probably null Het
Dglucy T C 12: 100,838,700 probably null Het
Dtx1 T G 5: 120,681,286 T616P possibly damaging Het
Eef1g T C 19: 8,969,977 L171P probably benign Het
Fam135a A G 1: 24,030,394 S465P probably damaging Het
Gm14025 A G 2: 129,039,601 L135P probably damaging Het
Gm14412 A T 2: 177,314,685 C472* probably null Het
Gm7104 T C 12: 88,286,042 noncoding transcript Het
Got2 A G 8: 95,888,230 S26P probably benign Het
H2-M11 A G 17: 36,549,231 I329M probably damaging Het
Hmcn2 T A 2: 31,382,394 D1295E possibly damaging Het
Hoxd12 G T 2: 74,675,427 R114L probably damaging Het
Ilkap A C 1: 91,387,250 D124E probably damaging Het
Med6 T C 12: 81,581,851 Y88C probably damaging Het
Mep1a A T 17: 43,475,041 L719* probably null Het
Mmp23 T C 4: 155,652,023 Y187C probably damaging Het
Myo1g A G 11: 6,520,760 M32T possibly damaging Het
Ncstn T C 1: 172,067,494 E614G probably benign Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr1309 G A 2: 111,983,297 T259M possibly damaging Het
Otub2 T A 12: 103,392,826 L58* probably null Het
Pcdhga12 G A 18: 37,767,629 V505I probably benign Het
Pcdhga9 T A 18: 37,737,844 V242D probably damaging Het
Pex1 C T 5: 3,626,084 L891F probably damaging Het
Pgm1 C T 5: 64,112,061 T497I probably benign Het
Pikfyve T C 1: 65,196,681 F171L probably damaging Het
Pilrb1 T G 5: 137,857,392 K79T probably benign Het
Pin1 C T 9: 20,655,364 R21W probably damaging Het
Ptprq A G 10: 107,686,392 probably benign Het
Rad17 G A 13: 100,622,863 A552V possibly damaging Het
Rbbp8 A G 18: 11,718,868 T249A probably benign Het
Rtkn A T 6: 83,135,976 I10F probably benign Het
Scube2 T A 7: 109,857,590 I103F possibly damaging Het
Sec23b A G 2: 144,581,973 H514R probably benign Het
Serbp1 T A 6: 67,272,220 D223E probably benign Het
Slc14a1 C A 18: 78,111,392 V260L probably benign Het
Slc22a23 A G 13: 34,183,126 I633T probably damaging Het
Stk19 A T 17: 34,824,747 probably benign Het
Svs2 T C 2: 164,237,127 M287V probably benign Het
Syne3 T A 12: 104,958,066 Q358L probably damaging Het
Synj1 A G 16: 91,010,096 F58L possibly damaging Het
Tg T C 15: 66,674,023 V198A probably damaging Het
Tle4 A T 19: 14,597,388 Y9N probably damaging Het
Tmem57 A G 4: 134,804,481 Y626H probably damaging Het
Tmx3 G A 18: 90,524,335 A186T possibly damaging Het
Traf3 G A 12: 111,255,245 S280N possibly damaging Het
Trmt13 A G 3: 116,581,518 F447S probably damaging Het
Trp53bp1 T A 2: 121,228,626 H918L probably damaging Het
Ush2a T G 1: 188,728,504 V2654G probably benign Het
Vmn2r25 A G 6: 123,840,098 Y175H probably damaging Het
Zfp335 T C 2: 164,892,189 D1330G probably damaging Het
Other mutations in Abi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Abi2 APN 1 60447346 missense probably damaging 1.00
IGL01369:Abi2 APN 1 60437056 missense probably damaging 1.00
IGL02028:Abi2 APN 1 60434283 missense probably damaging 1.00
IGL02074:Abi2 APN 1 60447307 missense probably damaging 1.00
IGL02897:Abi2 APN 1 60448194 missense probably damaging 0.96
IGL02957:Abi2 APN 1 60470786 missense probably damaging 1.00
1mM(1):Abi2 UTSW 1 60437057 missense probably damaging 1.00
P0026:Abi2 UTSW 1 60453723 missense probably benign 0.42
R0062:Abi2 UTSW 1 60453725 missense probably benign 0.42
R0062:Abi2 UTSW 1 60453725 missense probably benign 0.42
R4793:Abi2 UTSW 1 60409804 start codon destroyed probably null 1.00
R5110:Abi2 UTSW 1 60450121 missense probably benign 0.00
R5557:Abi2 UTSW 1 60438912 unclassified probably benign
R6037:Abi2 UTSW 1 60464579 missense probably damaging 1.00
R6037:Abi2 UTSW 1 60464579 missense probably damaging 1.00
R6368:Abi2 UTSW 1 60453651 missense possibly damaging 0.82
R6481:Abi2 UTSW 1 60438939 unclassified probably null
R7393:Abi2 UTSW 1 60434382 missense possibly damaging 0.92
R7460:Abi2 UTSW 1 60434307 missense probably damaging 1.00
R7573:Abi2 UTSW 1 60470708 missense probably benign 0.37
R7744:Abi2 UTSW 1 60437203 missense probably benign 0.00
Z1177:Abi2 UTSW 1 60437165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGATGAGTTTCCTTTAATGATGCG -3'
(R):5'- CACAGAAAACTATTCCAATGGAGG -3'

Sequencing Primer
(F):5'- CCTTTAATGATGCGTTTGTGTTC -3'
(R):5'- TTCCAATGGAGGAAGAGCAG -3'
Posted On2015-04-17