Mutagenetix > Incidental Mutation

Incidental Mutation 'R3946:Pikfyve'

307682

Institutional Source

Beutler Lab

Gene Symbol

Pikfyve

Ensembl Gene

ENSMUSG00000025949

Gene Name

phosphoinositide kinase, FYVE type zinc finger containing

Synonyms

Pip5k3

MMRRC Submission

040827-MU

Accession Numbers

Genbank: NM_011086

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3946 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

65186683-65278695 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 65196681 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 171 (F171L)

Ref Sequence

ENSEMBL: ENSMUSP00000095314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707] [ENSMUST00000185263] [ENSMUST00000190058]

AlphaFold

Q9Z1T6

Predicted Effect

probably damaging
Transcript: ENSMUST00000081154
AA Change: F182L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: F182L

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	161	230	5.95e-18	SMART
DEP	376	451	9.05e-27	SMART
Pfam:Cpn60_TCP1	547	822	2e-37	PFAM
low complexity region	1177	1189	N/A	INTRINSIC
low complexity region	1516	1536	N/A	INTRINSIC
PIPKc	1745	2039	3.03e-162	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000097707
AA Change: F171L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: F171L

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	150	219	5.95e-18	SMART
DEP	365	440	9.05e-27	SMART
Pfam:Cpn60_TCP1	590	864	1.8e-35	PFAM
low complexity region	1222	1234	N/A	INTRINSIC
low complexity region	1561	1581	N/A	INTRINSIC
PIPKc	1790	2084	3.03e-162	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000185263

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185317

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186404

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187579

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188799

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189925

Predicted Effect

probably benign
Transcript: ENSMUST00000190058

SMART Domains

Protein: ENSMUSP00000140204
Gene: ENSMUSG00000025949

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190847

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213081

Meta Mutation Damage Score

0.8868

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.1%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaed1	T	C	13: 64,309,098	I104V	probably damaging	Het
Abi2	A	G	1: 60,453,754	Q328R	probably damaging	Het
Agr3	C	A	12: 35,947,513		probably benign	Het
Brca2	T	A	5: 150,536,704	S481R	probably damaging	Het
Cabin1	T	G	10: 75,745,259	Q411P	probably damaging	Het
Calr3	A	G	8: 72,443,620	Y22H	probably damaging	Het
Caprin1	T	A	2: 103,796,766	I59F	probably damaging	Het
Cdk5rap1	T	C	2: 154,348,716	T442A	probably damaging	Het
Chn2	T	C	6: 54,269,426		probably benign	Het
Cic	C	A	7: 25,272,346	R501S	possibly damaging	Het
Coch	A	G	12: 51,601,812		probably null	Het
Defa25	G	A	8: 21,084,490	V17I	probably null	Het
Dglucy	T	C	12: 100,838,700		probably null	Het
Dtx1	T	G	5: 120,681,286	T616P	possibly damaging	Het
Eef1g	T	C	19: 8,969,977	L171P	probably benign	Het
Fam135a	A	G	1: 24,030,394	S465P	probably damaging	Het
Gm14025	A	G	2: 129,039,601	L135P	probably damaging	Het
Gm14412	A	T	2: 177,314,685	C472*	probably null	Het
Gm7104	T	C	12: 88,286,042		noncoding transcript	Het
Got2	A	G	8: 95,888,230	S26P	probably benign	Het
H2-M11	A	G	17: 36,549,231	I329M	probably damaging	Het
Hmcn2	T	A	2: 31,382,394	D1295E	possibly damaging	Het
Hoxd12	G	T	2: 74,675,427	R114L	probably damaging	Het
Ilkap	A	C	1: 91,387,250	D124E	probably damaging	Het
Med6	T	C	12: 81,581,851	Y88C	probably damaging	Het
Mep1a	A	T	17: 43,475,041	L719*	probably null	Het
Mmp23	T	C	4: 155,652,023	Y187C	probably damaging	Het
Myo1g	A	G	11: 6,520,760	M32T	possibly damaging	Het
Ncstn	T	C	1: 172,067,494	E614G	probably benign	Het
Nr2c2	C	T	6: 92,163,138	R464W	probably damaging	Het
Olfr1309	G	A	2: 111,983,297	T259M	possibly damaging	Het
Otub2	T	A	12: 103,392,826	L58*	probably null	Het
Pcdhga12	G	A	18: 37,767,629	V505I	probably benign	Het
Pcdhga9	T	A	18: 37,737,844	V242D	probably damaging	Het
Pex1	C	T	5: 3,626,084	L891F	probably damaging	Het
Pgm1	C	T	5: 64,112,061	T497I	probably benign	Het
Pilrb1	T	G	5: 137,857,392	K79T	probably benign	Het
Pin1	C	T	9: 20,655,364	R21W	probably damaging	Het
Ptprq	A	G	10: 107,686,392		probably benign	Het
Rad17	G	A	13: 100,622,863	A552V	possibly damaging	Het
Rbbp8	A	G	18: 11,718,868	T249A	probably benign	Het
Rtkn	A	T	6: 83,135,976	I10F	probably benign	Het
Scube2	T	A	7: 109,857,590	I103F	possibly damaging	Het
Sec23b	A	G	2: 144,581,973	H514R	probably benign	Het
Serbp1	T	A	6: 67,272,220	D223E	probably benign	Het
Slc14a1	C	A	18: 78,111,392	V260L	probably benign	Het
Slc22a23	A	G	13: 34,183,126	I633T	probably damaging	Het
Stk19	A	T	17: 34,824,747		probably benign	Het
Svs2	T	C	2: 164,237,127	M287V	probably benign	Het
Syne3	T	A	12: 104,958,066	Q358L	probably damaging	Het
Synj1	A	G	16: 91,010,096	F58L	possibly damaging	Het
Tg	T	C	15: 66,674,023	V198A	probably damaging	Het
Tle4	A	T	19: 14,597,388	Y9N	probably damaging	Het
Tmem57	A	G	4: 134,804,481	Y626H	probably damaging	Het
Tmx3	G	A	18: 90,524,335	A186T	possibly damaging	Het
Traf3	G	A	12: 111,255,245	S280N	possibly damaging	Het
Trmt13	A	G	3: 116,581,518	F447S	probably damaging	Het
Trp53bp1	T	A	2: 121,228,626	H918L	probably damaging	Het
Ush2a	T	G	1: 188,728,504	V2654G	probably benign	Het
Vmn2r25	A	G	6: 123,840,098	Y175H	probably damaging	Het
Zfp335	T	C	2: 164,892,189	D1330G	probably damaging	Het

Other mutations in Pikfyve

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Pikfyve	APN	1	65260121	critical splice donor site	probably null
IGL01135:Pikfyve	APN	1	65251635	missense	probably damaging	0.96
IGL01511:Pikfyve	APN	1	65258869	nonsense	probably null
IGL01759:Pikfyve	APN	1	65253353	missense	probably benign	0.06
IGL01888:Pikfyve	APN	1	65223640	missense	probably damaging	1.00
IGL01967:Pikfyve	APN	1	65264365	missense	possibly damaging	0.89
IGL02055:Pikfyve	APN	1	65238544	critical splice donor site	probably null
IGL02119:Pikfyve	APN	1	65272571	missense	probably damaging	1.00
IGL02141:Pikfyve	APN	1	65246397	missense	probably benign	0.13
IGL02207:Pikfyve	APN	1	65251678	critical splice donor site	probably null
IGL02380:Pikfyve	APN	1	65256021	missense	probably damaging	0.99
IGL02400:Pikfyve	APN	1	65252569	missense	probably damaging	1.00
IGL02403:Pikfyve	APN	1	65244504	missense	probably damaging	0.99
IGL02426:Pikfyve	APN	1	65251612	missense	possibly damaging	0.77
IGL02496:Pikfyve	APN	1	65264376	missense	possibly damaging	0.94
IGL02573:Pikfyve	APN	1	65230855	critical splice donor site	probably null
IGL02746:Pikfyve	APN	1	65234272	missense	probably damaging	1.00
IGL02814:Pikfyve	APN	1	65250194	nonsense	probably null
IGL02890:Pikfyve	APN	1	65230797	missense	probably benign	0.00
IGL03102:Pikfyve	APN	1	65252467	nonsense	probably null
IGL03294:Pikfyve	APN	1	65247067	missense	probably damaging	1.00
falcon	UTSW	1	65196741	missense	probably damaging	1.00
oompa	UTSW	1	65196706	missense	probably damaging	1.00
wonka	UTSW	1	65196706	missense	probably damaging	1.00
G5538:Pikfyve	UTSW	1	65202916	missense	probably damaging	1.00
R0031:Pikfyve	UTSW	1	65215929	splice site	probably benign
R0196:Pikfyve	UTSW	1	65256072	missense	possibly damaging	0.92
R0212:Pikfyve	UTSW	1	65262905	missense	probably benign	0.41
R0319:Pikfyve	UTSW	1	65246331	missense	probably benign	0.01
R0332:Pikfyve	UTSW	1	65264399	missense	probably benign	0.02
R0389:Pikfyve	UTSW	1	65196706	missense	probably damaging	1.00
R0443:Pikfyve	UTSW	1	65196706	missense	probably damaging	1.00
R0503:Pikfyve	UTSW	1	65219899	missense	probably damaging	0.97
R0722:Pikfyve	UTSW	1	65253523	missense	probably damaging	0.99
R0906:Pikfyve	UTSW	1	65253397	missense	probably damaging	1.00
R0907:Pikfyve	UTSW	1	65202830	missense	possibly damaging	0.64
R0970:Pikfyve	UTSW	1	65265824	missense	probably damaging	0.99
R1188:Pikfyve	UTSW	1	65246959	missense	possibly damaging	0.46
R1412:Pikfyve	UTSW	1	65202830	missense	possibly damaging	0.64
R1421:Pikfyve	UTSW	1	65271311	missense	probably damaging	1.00
R1468:Pikfyve	UTSW	1	65251666	missense	probably damaging	0.98
R1468:Pikfyve	UTSW	1	65251666	missense	probably damaging	0.98
R1472:Pikfyve	UTSW	1	65224201	missense	probably damaging	0.96
R1478:Pikfyve	UTSW	1	65262977	critical splice donor site	probably null
R1501:Pikfyve	UTSW	1	65265284	missense	possibly damaging	0.84
R1757:Pikfyve	UTSW	1	65252548	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65192271	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65246370	missense	probably benign
R1795:Pikfyve	UTSW	1	65252557	missense	probably damaging	1.00
R1855:Pikfyve	UTSW	1	65258798	missense	probably benign	0.03
R1905:Pikfyve	UTSW	1	65192295	critical splice donor site	probably null
R1995:Pikfyve	UTSW	1	65246708	missense	probably damaging	1.00
R2034:Pikfyve	UTSW	1	65222357	missense	probably damaging	1.00
R2045:Pikfyve	UTSW	1	65253353	missense	probably benign	0.06
R2229:Pikfyve	UTSW	1	65267855	missense	probably damaging	1.00
R2295:Pikfyve	UTSW	1	65246676	missense	probably damaging	0.99
R2913:Pikfyve	UTSW	1	65253517	missense	probably damaging	1.00
R3818:Pikfyve	UTSW	1	65245758	missense	probably damaging	1.00
R3832:Pikfyve	UTSW	1	65244420	missense	probably damaging	0.99
R3850:Pikfyve	UTSW	1	65230845	missense	probably damaging	1.00
R4105:Pikfyve	UTSW	1	65190520	unclassified	probably benign
R4542:Pikfyve	UTSW	1	65244430	missense	probably damaging	1.00
R4574:Pikfyve	UTSW	1	65192192	missense	probably damaging	1.00
R4601:Pikfyve	UTSW	1	65234262	missense	probably damaging	1.00
R4667:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4668:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4669:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4707:Pikfyve	UTSW	1	65267846	missense	probably benign
R4716:Pikfyve	UTSW	1	65246476	missense	possibly damaging	0.84
R4758:Pikfyve	UTSW	1	65272515	missense	possibly damaging	0.84
R4784:Pikfyve	UTSW	1	65267846	missense	probably benign
R4785:Pikfyve	UTSW	1	65267846	missense	probably benign
R4805:Pikfyve	UTSW	1	65268800	missense	probably damaging	0.99
R4831:Pikfyve	UTSW	1	65196741	missense	probably damaging	1.00
R4837:Pikfyve	UTSW	1	65246590	missense	possibly damaging	0.92
R5064:Pikfyve	UTSW	1	65253407	missense	probably damaging	1.00
R5115:Pikfyve	UTSW	1	65224117	intron	probably benign
R5265:Pikfyve	UTSW	1	65267829	missense	possibly damaging	0.72
R5279:Pikfyve	UTSW	1	65196699	nonsense	probably null
R5384:Pikfyve	UTSW	1	65244409	missense	probably damaging	1.00
R5387:Pikfyve	UTSW	1	65265268	missense	possibly damaging	0.94
R5461:Pikfyve	UTSW	1	65235033	missense	probably damaging	1.00
R5467:Pikfyve	UTSW	1	65252495	missense	probably damaging	1.00
R5560:Pikfyve	UTSW	1	65253407	missense	probably damaging	1.00
R5575:Pikfyve	UTSW	1	65273730	missense	probably damaging	1.00
R5611:Pikfyve	UTSW	1	65256088	missense	probably damaging	0.96
R5663:Pikfyve	UTSW	1	65216028	missense	probably benign	0.09
R5891:Pikfyve	UTSW	1	65202737	missense	probably damaging	1.00
R5960:Pikfyve	UTSW	1	65253438	nonsense	probably null
R6026:Pikfyve	UTSW	1	65272697	missense	probably damaging	1.00
R6057:Pikfyve	UTSW	1	65272571	missense	probably damaging	1.00
R6101:Pikfyve	UTSW	1	65264345	critical splice acceptor site	probably null
R6105:Pikfyve	UTSW	1	65264345	critical splice acceptor site	probably null
R6161:Pikfyve	UTSW	1	65216043	missense	probably benign	0.36
R6287:Pikfyve	UTSW	1	65253532	critical splice donor site	probably null
R6290:Pikfyve	UTSW	1	65202925	critical splice donor site	probably null
R6296:Pikfyve	UTSW	1	65262953	missense	probably damaging	0.99
R6516:Pikfyve	UTSW	1	65265781	missense	probably benign	0.35
R6835:Pikfyve	UTSW	1	65258843	missense	probably damaging	0.98
R6994:Pikfyve	UTSW	1	65252530	missense	probably damaging	1.00
R6997:Pikfyve	UTSW	1	65246663	missense	probably damaging	1.00
R7038:Pikfyve	UTSW	1	65234361	missense	probably damaging	1.00
R7044:Pikfyve	UTSW	1	65246854	missense	probably benign	0.01
R7057:Pikfyve	UTSW	1	65247205	missense	probably benign	0.00
R7525:Pikfyve	UTSW	1	65244426	nonsense	probably null
R7558:Pikfyve	UTSW	1	65272623	missense	probably benign	0.01
R7625:Pikfyve	UTSW	1	65267877	missense	possibly damaging	0.86
R7807:Pikfyve	UTSW	1	65269942	missense	probably damaging	1.00
R7961:Pikfyve	UTSW	1	65255134	missense	probably damaging	1.00
R8009:Pikfyve	UTSW	1	65255134	missense	probably damaging	1.00
R8154:Pikfyve	UTSW	1	65265789	missense	probably damaging	1.00
R8192:Pikfyve	UTSW	1	65246395	missense	possibly damaging	0.93
R8275:Pikfyve	UTSW	1	65253342	splice site	probably benign
R8307:Pikfyve	UTSW	1	65245735	missense	possibly damaging	0.77
R8710:Pikfyve	UTSW	1	65215996	missense	possibly damaging	0.94
R8867:Pikfyve	UTSW	1	65244417	missense	probably damaging	1.00
R8936:Pikfyve	UTSW	1	65271268	missense	possibly damaging	0.84
R8940:Pikfyve	UTSW	1	65246970	missense	probably benign	0.00
R8995:Pikfyve	UTSW	1	65205587	critical splice acceptor site	probably null
R9092:Pikfyve	UTSW	1	65244400	missense	probably damaging	1.00
R9131:Pikfyve	UTSW	1	65246080	missense	probably damaging	1.00
R9151:Pikfyve	UTSW	1	65196739	missense	probably damaging	1.00
R9210:Pikfyve	UTSW	1	65252560	missense	probably damaging	1.00
R9212:Pikfyve	UTSW	1	65252560	missense	probably damaging	1.00
R9235:Pikfyve	UTSW	1	65260029	missense	probably benign	0.37
R9368:Pikfyve	UTSW	1	65268742	missense	probably damaging	1.00
R9489:Pikfyve	UTSW	1	65264402	missense	probably benign
R9605:Pikfyve	UTSW	1	65264402	missense	probably benign
R9686:Pikfyve	UTSW	1	65252456	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCCTGAGTTCTGAGAGTGAG -3'
(R):5'- CACCTCCTTTATTACTCAAGCATAAAG -3'

Sequencing Primer
(F):5'- TGGCCCAGAACTCAGAGATCTG -3'
(R):5'- GCATAAAGTTCCTAAAATCAAAGCTG -3'

Posted On

2015-04-17