Incidental Mutation 'R3946:Ilkap'
ID 307683
Institutional Source Beutler Lab
Gene Symbol Ilkap
Ensembl Gene ENSMUSG00000026309
Gene Name integrin-linked kinase-associated serine/threonine phosphatase 2C
Synonyms 1600009O09Rik, PP2C-DELTA, 0710007A14Rik
MMRRC Submission 040827-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.217) question?
Stock # R3946 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 91301583-91326537 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 91314972 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 124 (D124E)
Ref Sequence ENSEMBL: ENSMUSP00000140048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027534] [ENSMUST00000186986] [ENSMUST00000187306] [ENSMUST00000190519] [ENSMUST00000190747] [ENSMUST00000187678]
AlphaFold Q8R0F6
Predicted Effect possibly damaging
Transcript: ENSMUST00000027534
AA Change: D130E

PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000027534
Gene: ENSMUSG00000026309
AA Change: D130E

DomainStartEndE-ValueType
Blast:PP2C_SIG 26 64 4e-12 BLAST
PP2Cc 94 388 4.47e-93 SMART
PP2C_SIG 128 390 9.82e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186433
Predicted Effect probably benign
Transcript: ENSMUST00000186986
SMART Domains Protein: ENSMUSP00000140074
Gene: ENSMUSG00000026309

DomainStartEndE-ValueType
Blast:PP2Cc 7 72 9e-24 BLAST
low complexity region 83 96 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187105
Predicted Effect probably benign
Transcript: ENSMUST00000187231
Predicted Effect probably benign
Transcript: ENSMUST00000187306
SMART Domains Protein: ENSMUSP00000139834
Gene: ENSMUSG00000026309

DomainStartEndE-ValueType
Blast:PP2Cc 7 73 2e-24 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000190519
AA Change: D124E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140048
Gene: ENSMUSG00000026309
AA Change: D124E

DomainStartEndE-ValueType
Blast:PP2C_SIG 26 136 2e-36 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189651
Predicted Effect probably benign
Transcript: ENSMUST00000190747
SMART Domains Protein: ENSMUSP00000140905
Gene: ENSMUSG00000026309

DomainStartEndE-ValueType
PP2Cc 1 164 7.3e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187678
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protein serine/threonine phosphatase of the PP2C family. This protein can interact with integrin-linked kinase (ILK/ILK1), a regulator of integrin mediated signaling, and regulate the kinase activity of ILK. Through the interaction with ILK, this protein may selectively affect the signaling process of ILK-mediated glycogen synthase kinase 3 beta (GSK3beta), and thus participate in Wnt signaling pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null gene trap insertion exhibit enhanced motor coordination, and male homozygous mice exhibit increased cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi2 A G 1: 60,492,913 (GRCm39) Q328R probably damaging Het
Agr3 C A 12: 35,997,512 (GRCm39) probably benign Het
Brca2 T A 5: 150,460,169 (GRCm39) S481R probably damaging Het
Cabin1 T G 10: 75,581,093 (GRCm39) Q411P probably damaging Het
Calr3 A G 8: 73,197,464 (GRCm39) Y22H probably damaging Het
Caprin1 T A 2: 103,627,111 (GRCm39) I59F probably damaging Het
Cdk5rap1 T C 2: 154,190,636 (GRCm39) T442A probably damaging Het
Chn2 T C 6: 54,246,411 (GRCm39) probably benign Het
Cic C A 7: 24,971,771 (GRCm39) R501S possibly damaging Het
Coch A G 12: 51,648,595 (GRCm39) probably null Het
Defa25 G A 8: 21,574,506 (GRCm39) V17I probably null Het
Dglucy T C 12: 100,804,959 (GRCm39) probably null Het
Dtx1 T G 5: 120,819,351 (GRCm39) T616P possibly damaging Het
Eef1g T C 19: 8,947,341 (GRCm39) L171P probably benign Het
Fam135a A G 1: 24,069,475 (GRCm39) S465P probably damaging Het
Gm14412 A T 2: 177,006,478 (GRCm39) C472* probably null Het
Gm7104 T C 12: 88,252,812 (GRCm39) noncoding transcript Het
Got2 A G 8: 96,614,858 (GRCm39) S26P probably benign Het
H2-M11 A G 17: 36,860,123 (GRCm39) I329M probably damaging Het
Hmcn2 T A 2: 31,272,406 (GRCm39) D1295E possibly damaging Het
Hoxd12 G T 2: 74,505,771 (GRCm39) R114L probably damaging Het
Maco1 A G 4: 134,531,792 (GRCm39) Y626H probably damaging Het
Med6 T C 12: 81,628,625 (GRCm39) Y88C probably damaging Het
Mep1a A T 17: 43,785,932 (GRCm39) L719* probably null Het
Mmp23 T C 4: 155,736,480 (GRCm39) Y187C probably damaging Het
Myo1g A G 11: 6,470,760 (GRCm39) M32T possibly damaging Het
Ncstn T C 1: 171,895,061 (GRCm39) E614G probably benign Het
Nr2c2 C T 6: 92,140,119 (GRCm39) R464W probably damaging Het
Or4f15 G A 2: 111,813,642 (GRCm39) T259M possibly damaging Het
Otub2 T A 12: 103,359,085 (GRCm39) L58* probably null Het
Pcdhga12 G A 18: 37,900,682 (GRCm39) V505I probably benign Het
Pcdhga9 T A 18: 37,870,897 (GRCm39) V242D probably damaging Het
Pex1 C T 5: 3,676,084 (GRCm39) L891F probably damaging Het
Pgm2 C T 5: 64,269,404 (GRCm39) T497I probably benign Het
Pikfyve T C 1: 65,235,840 (GRCm39) F171L probably damaging Het
Pilrb1 T G 5: 137,855,654 (GRCm39) K79T probably benign Het
Pin1 C T 9: 20,566,660 (GRCm39) R21W probably damaging Het
Prxl2c T C 13: 64,456,912 (GRCm39) I104V probably damaging Het
Ptprq A G 10: 107,522,253 (GRCm39) probably benign Het
Rad17 G A 13: 100,759,371 (GRCm39) A552V possibly damaging Het
Rbbp8 A G 18: 11,851,925 (GRCm39) T249A probably benign Het
Rtkn A T 6: 83,112,957 (GRCm39) I10F probably benign Het
Scube2 T A 7: 109,456,797 (GRCm39) I103F possibly damaging Het
Sec23b A G 2: 144,423,893 (GRCm39) H514R probably benign Het
Serbp1 T A 6: 67,249,204 (GRCm39) D223E probably benign Het
Slc14a1 C A 18: 78,154,607 (GRCm39) V260L probably benign Het
Slc22a23 A G 13: 34,367,109 (GRCm39) I633T probably damaging Het
Stk19 A T 17: 35,043,723 (GRCm39) probably benign Het
Svs5 T C 2: 164,079,047 (GRCm39) M287V probably benign Het
Syne3 T A 12: 104,924,325 (GRCm39) Q358L probably damaging Het
Synj1 A G 16: 90,806,984 (GRCm39) F58L possibly damaging Het
Tg T C 15: 66,545,872 (GRCm39) V198A probably damaging Het
Tle4 A T 19: 14,574,752 (GRCm39) Y9N probably damaging Het
Tmx3 G A 18: 90,542,459 (GRCm39) A186T possibly damaging Het
Traf3 G A 12: 111,221,679 (GRCm39) S280N possibly damaging Het
Trmt13 A G 3: 116,375,167 (GRCm39) F447S probably damaging Het
Trp53bp1 T A 2: 121,059,107 (GRCm39) H918L probably damaging Het
Ush2a T G 1: 188,460,701 (GRCm39) V2654G probably benign Het
Vinac1 A G 2: 128,881,521 (GRCm39) L135P probably damaging Het
Vmn2r25 A G 6: 123,817,057 (GRCm39) Y175H probably damaging Het
Zfp335 T C 2: 164,734,109 (GRCm39) D1330G probably damaging Het
Other mutations in Ilkap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Ilkap APN 1 91,312,960 (GRCm39) critical splice donor site probably null
PIT4445001:Ilkap UTSW 1 91,313,067 (GRCm39) missense probably benign
R0184:Ilkap UTSW 1 91,304,027 (GRCm39) unclassified probably benign
R0782:Ilkap UTSW 1 91,306,272 (GRCm39) missense probably damaging 1.00
R1366:Ilkap UTSW 1 91,314,937 (GRCm39) missense possibly damaging 0.58
R1552:Ilkap UTSW 1 91,312,316 (GRCm39) missense probably damaging 1.00
R2155:Ilkap UTSW 1 91,312,345 (GRCm39) missense possibly damaging 0.65
R4005:Ilkap UTSW 1 91,312,985 (GRCm39) missense probably benign 0.03
R4860:Ilkap UTSW 1 91,315,105 (GRCm39) unclassified probably benign
R5666:Ilkap UTSW 1 91,318,863 (GRCm39) missense probably benign 0.38
R5670:Ilkap UTSW 1 91,318,863 (GRCm39) missense probably benign 0.38
R7324:Ilkap UTSW 1 91,313,115 (GRCm39) splice site probably null
R8493:Ilkap UTSW 1 91,306,266 (GRCm39) missense probably damaging 1.00
R8548:Ilkap UTSW 1 91,318,882 (GRCm39) missense possibly damaging 0.81
R9227:Ilkap UTSW 1 91,314,937 (GRCm39) missense probably benign 0.41
R9230:Ilkap UTSW 1 91,314,937 (GRCm39) missense probably benign 0.41
R9620:Ilkap UTSW 1 91,303,973 (GRCm39) missense
R9694:Ilkap UTSW 1 91,303,973 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TCTAAGATCCACTGATGCAAAAGG -3'
(R):5'- GCAGAACCCTGAATTGTGGC -3'

Sequencing Primer
(F):5'- GCAGGTTACTCATGGCGTCAG -3'
(R):5'- ACCACTGTGATGTTGCTGAGC -3'
Posted On 2015-04-17