Incidental Mutation 'R3946:Ilkap'
ID307683
Institutional Source Beutler Lab
Gene Symbol Ilkap
Ensembl Gene ENSMUSG00000026309
Gene Nameintegrin-linked kinase-associated serine/threonine phosphatase 2C
Synonyms1600009O09Rik, 0710007A14Rik, PP2C-DELTA
MMRRC Submission 040827-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.264) question?
Stock #R3946 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location91373861-91398815 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 91387250 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 124 (D124E)
Ref Sequence ENSEMBL: ENSMUSP00000140048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027534] [ENSMUST00000186986] [ENSMUST00000187306] [ENSMUST00000187678] [ENSMUST00000190519] [ENSMUST00000190747]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027534
AA Change: D130E

PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000027534
Gene: ENSMUSG00000026309
AA Change: D130E

DomainStartEndE-ValueType
Blast:PP2C_SIG 26 64 4e-12 BLAST
PP2Cc 94 388 4.47e-93 SMART
PP2C_SIG 128 390 9.82e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186433
Predicted Effect probably benign
Transcript: ENSMUST00000186986
SMART Domains Protein: ENSMUSP00000140074
Gene: ENSMUSG00000026309

DomainStartEndE-ValueType
Blast:PP2Cc 7 72 9e-24 BLAST
low complexity region 83 96 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187105
Predicted Effect probably benign
Transcript: ENSMUST00000187231
Predicted Effect probably benign
Transcript: ENSMUST00000187306
SMART Domains Protein: ENSMUSP00000139834
Gene: ENSMUSG00000026309

DomainStartEndE-ValueType
Blast:PP2Cc 7 73 2e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000187678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189651
Predicted Effect probably damaging
Transcript: ENSMUST00000190519
AA Change: D124E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140048
Gene: ENSMUSG00000026309
AA Change: D124E

DomainStartEndE-ValueType
Blast:PP2C_SIG 26 136 2e-36 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000190747
SMART Domains Protein: ENSMUSP00000140905
Gene: ENSMUSG00000026309

DomainStartEndE-ValueType
PP2Cc 1 164 7.3e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191230
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protein serine/threonine phosphatase of the PP2C family. This protein can interact with integrin-linked kinase (ILK/ILK1), a regulator of integrin mediated signaling, and regulate the kinase activity of ILK. Through the interaction with ILK, this protein may selectively affect the signaling process of ILK-mediated glycogen synthase kinase 3 beta (GSK3beta), and thus participate in Wnt signaling pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null gene trap insertion exhibit enhanced motor coordination, and male homozygous mice exhibit increased cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 T C 13: 64,309,098 I104V probably damaging Het
Abi2 A G 1: 60,453,754 Q328R probably damaging Het
Agr3 C A 12: 35,947,513 probably benign Het
Brca2 T A 5: 150,536,704 S481R probably damaging Het
Cabin1 T G 10: 75,745,259 Q411P probably damaging Het
Calr3 A G 8: 72,443,620 Y22H probably damaging Het
Caprin1 T A 2: 103,796,766 I59F probably damaging Het
Cdk5rap1 T C 2: 154,348,716 T442A probably damaging Het
Chn2 T C 6: 54,269,426 probably benign Het
Cic C A 7: 25,272,346 R501S possibly damaging Het
Coch A G 12: 51,601,812 probably null Het
Defa25 G A 8: 21,084,490 V17I probably null Het
Dglucy T C 12: 100,838,700 probably null Het
Dtx1 T G 5: 120,681,286 T616P possibly damaging Het
Eef1g T C 19: 8,969,977 L171P probably benign Het
Fam135a A G 1: 24,030,394 S465P probably damaging Het
Gm14025 A G 2: 129,039,601 L135P probably damaging Het
Gm14412 A T 2: 177,314,685 C472* probably null Het
Gm7104 T C 12: 88,286,042 noncoding transcript Het
Got2 A G 8: 95,888,230 S26P probably benign Het
H2-M11 A G 17: 36,549,231 I329M probably damaging Het
Hmcn2 T A 2: 31,382,394 D1295E possibly damaging Het
Hoxd12 G T 2: 74,675,427 R114L probably damaging Het
Med6 T C 12: 81,581,851 Y88C probably damaging Het
Mep1a A T 17: 43,475,041 L719* probably null Het
Mmp23 T C 4: 155,652,023 Y187C probably damaging Het
Myo1g A G 11: 6,520,760 M32T possibly damaging Het
Ncstn T C 1: 172,067,494 E614G probably benign Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr1309 G A 2: 111,983,297 T259M possibly damaging Het
Otub2 T A 12: 103,392,826 L58* probably null Het
Pcdhga12 G A 18: 37,767,629 V505I probably benign Het
Pcdhga9 T A 18: 37,737,844 V242D probably damaging Het
Pex1 C T 5: 3,626,084 L891F probably damaging Het
Pgm1 C T 5: 64,112,061 T497I probably benign Het
Pikfyve T C 1: 65,196,681 F171L probably damaging Het
Pilrb1 T G 5: 137,857,392 K79T probably benign Het
Pin1 C T 9: 20,655,364 R21W probably damaging Het
Ptprq A G 10: 107,686,392 probably benign Het
Rad17 G A 13: 100,622,863 A552V possibly damaging Het
Rbbp8 A G 18: 11,718,868 T249A probably benign Het
Rtkn A T 6: 83,135,976 I10F probably benign Het
Scube2 T A 7: 109,857,590 I103F possibly damaging Het
Sec23b A G 2: 144,581,973 H514R probably benign Het
Serbp1 T A 6: 67,272,220 D223E probably benign Het
Slc14a1 C A 18: 78,111,392 V260L probably benign Het
Slc22a23 A G 13: 34,183,126 I633T probably damaging Het
Stk19 A T 17: 34,824,747 probably benign Het
Svs2 T C 2: 164,237,127 M287V probably benign Het
Syne3 T A 12: 104,958,066 Q358L probably damaging Het
Synj1 A G 16: 91,010,096 F58L possibly damaging Het
Tg T C 15: 66,674,023 V198A probably damaging Het
Tle4 A T 19: 14,597,388 Y9N probably damaging Het
Tmem57 A G 4: 134,804,481 Y626H probably damaging Het
Tmx3 G A 18: 90,524,335 A186T possibly damaging Het
Traf3 G A 12: 111,255,245 S280N possibly damaging Het
Trmt13 A G 3: 116,581,518 F447S probably damaging Het
Trp53bp1 T A 2: 121,228,626 H918L probably damaging Het
Ush2a T G 1: 188,728,504 V2654G probably benign Het
Vmn2r25 A G 6: 123,840,098 Y175H probably damaging Het
Zfp335 T C 2: 164,892,189 D1330G probably damaging Het
Other mutations in Ilkap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Ilkap APN 1 91385238 critical splice donor site probably null
PIT4445001:Ilkap UTSW 1 91385345 missense probably benign
R0184:Ilkap UTSW 1 91376305 unclassified probably benign
R0782:Ilkap UTSW 1 91378550 missense probably damaging 1.00
R1366:Ilkap UTSW 1 91387215 missense possibly damaging 0.58
R1552:Ilkap UTSW 1 91384594 missense probably damaging 1.00
R2155:Ilkap UTSW 1 91384623 missense possibly damaging 0.65
R4005:Ilkap UTSW 1 91385263 missense probably benign 0.03
R4860:Ilkap UTSW 1 91387383 unclassified probably benign
R5666:Ilkap UTSW 1 91391141 missense probably benign 0.38
R5670:Ilkap UTSW 1 91391141 missense probably benign 0.38
R7324:Ilkap UTSW 1 91385393 intron probably null
Predicted Primers PCR Primer
(F):5'- TCTAAGATCCACTGATGCAAAAGG -3'
(R):5'- GCAGAACCCTGAATTGTGGC -3'

Sequencing Primer
(F):5'- GCAGGTTACTCATGGCGTCAG -3'
(R):5'- ACCACTGTGATGTTGCTGAGC -3'
Posted On2015-04-17