Mutagenetix > Incidental Mutations

Incidental Mutation 'R3946:Ncstn'

307684

Institutional Source

Beutler Lab

Gene Symbol

Ncstn

Ensembl Gene

ENSMUSG00000003458

Gene Name

nicastrin

Synonyms

Nct, nicastrin, D1Dau13e, 9430068N19Rik

MMRRC Submission

040827-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3946 (G1)

Quality Score

223

Status

Validated

Chromosome

Chromosomal Location

172066013-172082795 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 172067494 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 614 (E614G)

Ref Sequence

ENSEMBL: ENSMUSP00000003550 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003550] [ENSMUST00000140643] [ENSMUST00000146137]

Predicted Effect

probably benign
Transcript: ENSMUST00000003550
AA Change: E614G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000003550
Gene: ENSMUSG00000003458
AA Change: E614G

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Peptidase_M28	254	468	2.9e-7	PFAM
Pfam:Nicastrin	273	498	1.6e-94	PFAM
transmembrane domain	669	691	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122986

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135928

Predicted Effect

probably benign
Transcript: ENSMUST00000140643

SMART Domains

Protein: ENSMUSP00000119128
Gene: ENSMUSG00000003458

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000146137

SMART Domains

Protein: ENSMUSP00000120663
Gene: ENSMUSG00000003458

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.1%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I transmembrane glycoprotein that is an integral component of the multimeric gamma-secretase complex. The encoded protein cleaves integral membrane proteins, including Notch receptors and beta-amyloid precursor protein, and may be a stabilizing cofactor required for gamma-secretase complex assembly. The cleavage of beta-amyloid precursor protein yields amyloid beta peptide, the main component of the neuritic plaque and the hallmark lesion in the brains of patients with Alzheimer's disease; however, the nature of the encoded protein's role in Alzheimer's disease is not known for certain. Mutations in this gene are associated with familial acne inversa. A pseudogene of this gene is present on chromosome 21. Alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant embryos die exhibiting morphological defects of the somites, yolk sac vasculature, neural tube, and pericardial sacs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaed1	T	C	13: 64,309,098	I104V	probably damaging	Het
Abi2	A	G	1: 60,453,754	Q328R	probably damaging	Het
Agr3	C	A	12: 35,947,513		probably benign	Het
Brca2	T	A	5: 150,536,704	S481R	probably damaging	Het
Cabin1	T	G	10: 75,745,259	Q411P	probably damaging	Het
Calr3	A	G	8: 72,443,620	Y22H	probably damaging	Het
Caprin1	T	A	2: 103,796,766	I59F	probably damaging	Het
Cdk5rap1	T	C	2: 154,348,716	T442A	probably damaging	Het
Chn2	T	C	6: 54,269,426		probably benign	Het
Cic	C	A	7: 25,272,346	R501S	possibly damaging	Het
Coch	A	G	12: 51,601,812		probably null	Het
Defa25	G	A	8: 21,084,490	V17I	probably null	Het
Dglucy	T	C	12: 100,838,700		probably null	Het
Dtx1	T	G	5: 120,681,286	T616P	possibly damaging	Het
Eef1g	T	C	19: 8,969,977	L171P	probably benign	Het
Fam135a	A	G	1: 24,030,394	S465P	probably damaging	Het
Gm14025	A	G	2: 129,039,601	L135P	probably damaging	Het
Gm14412	A	T	2: 177,314,685	C472*	probably null	Het
Gm7104	T	C	12: 88,286,042		noncoding transcript	Het
Got2	A	G	8: 95,888,230	S26P	probably benign	Het
H2-M11	A	G	17: 36,549,231	I329M	probably damaging	Het
Hmcn2	T	A	2: 31,382,394	D1295E	possibly damaging	Het
Hoxd12	G	T	2: 74,675,427	R114L	probably damaging	Het
Ilkap	A	C	1: 91,387,250	D124E	probably damaging	Het
Med6	T	C	12: 81,581,851	Y88C	probably damaging	Het
Mep1a	A	T	17: 43,475,041	L719*	probably null	Het
Mmp23	T	C	4: 155,652,023	Y187C	probably damaging	Het
Myo1g	A	G	11: 6,520,760	M32T	possibly damaging	Het
Nr2c2	C	T	6: 92,163,138	R464W	probably damaging	Het
Olfr1309	G	A	2: 111,983,297	T259M	possibly damaging	Het
Otub2	T	A	12: 103,392,826	L58*	probably null	Het
Pcdhga12	G	A	18: 37,767,629	V505I	probably benign	Het
Pcdhga9	T	A	18: 37,737,844	V242D	probably damaging	Het
Pex1	C	T	5: 3,626,084	L891F	probably damaging	Het
Pgm1	C	T	5: 64,112,061	T497I	probably benign	Het
Pikfyve	T	C	1: 65,196,681	F171L	probably damaging	Het
Pilrb1	T	G	5: 137,857,392	K79T	probably benign	Het
Pin1	C	T	9: 20,655,364	R21W	probably damaging	Het
Ptprq	A	G	10: 107,686,392		probably benign	Het
Rad17	G	A	13: 100,622,863	A552V	possibly damaging	Het
Rbbp8	A	G	18: 11,718,868	T249A	probably benign	Het
Rtkn	A	T	6: 83,135,976	I10F	probably benign	Het
Scube2	T	A	7: 109,857,590	I103F	possibly damaging	Het
Sec23b	A	G	2: 144,581,973	H514R	probably benign	Het
Serbp1	T	A	6: 67,272,220	D223E	probably benign	Het
Slc14a1	C	A	18: 78,111,392	V260L	probably benign	Het
Slc22a23	A	G	13: 34,183,126	I633T	probably damaging	Het
Stk19	A	T	17: 34,824,747		probably benign	Het
Svs2	T	C	2: 164,237,127	M287V	probably benign	Het
Syne3	T	A	12: 104,958,066	Q358L	probably damaging	Het
Synj1	A	G	16: 91,010,096	F58L	possibly damaging	Het
Tg	T	C	15: 66,674,023	V198A	probably damaging	Het
Tle4	A	T	19: 14,597,388	Y9N	probably damaging	Het
Tmem57	A	G	4: 134,804,481	Y626H	probably damaging	Het
Tmx3	G	A	18: 90,524,335	A186T	possibly damaging	Het
Traf3	G	A	12: 111,255,245	S280N	possibly damaging	Het
Trmt13	A	G	3: 116,581,518	F447S	probably damaging	Het
Trp53bp1	T	A	2: 121,228,626	H918L	probably damaging	Het
Ush2a	T	G	1: 188,728,504	V2654G	probably benign	Het
Vmn2r25	A	G	6: 123,840,098	Y175H	probably damaging	Het
Zfp335	T	C	2: 164,892,189	D1330G	probably damaging	Het

Other mutations in Ncstn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00737:Ncstn	APN	1	172074401	missense	probably benign	0.02
IGL02030:Ncstn	APN	1	172072457	splice site	probably benign
IGL02470:Ncstn	APN	1	172082599	critical splice donor site	probably null
IGL02498:Ncstn	APN	1	172068592	missense	probably benign
morel	UTSW	1	172072476	missense	probably damaging	0.99
Pig	UTSW	1	172071525	missense	probably damaging	1.00
truffle	UTSW	1	172070009	missense	probably damaging	1.00
R0048:Ncstn	UTSW	1	172069961	splice site	probably benign
R0480:Ncstn	UTSW	1	172082592	splice site	probably benign
R0648:Ncstn	UTSW	1	172067887	missense	probably benign	0.01
R0792:Ncstn	UTSW	1	172071505	missense	possibly damaging	0.95
R1330:Ncstn	UTSW	1	172071525	missense	probably damaging	1.00
R1524:Ncstn	UTSW	1	172072149	missense	possibly damaging	0.58
R1660:Ncstn	UTSW	1	172066772	missense	possibly damaging	0.78
R1828:Ncstn	UTSW	1	172071471	frame shift	probably null
R1892:Ncstn	UTSW	1	172071471	frame shift	probably null
R1907:Ncstn	UTSW	1	172072143	missense	probably damaging	0.97
R3722:Ncstn	UTSW	1	172067895	missense	possibly damaging	0.50
R3876:Ncstn	UTSW	1	172070073	missense	probably benign	0.02
R3969:Ncstn	UTSW	1	172070009	missense	probably damaging	1.00
R4108:Ncstn	UTSW	1	172072544	missense	probably damaging	1.00
R4597:Ncstn	UTSW	1	172068256	nonsense	probably null
R4998:Ncstn	UTSW	1	172071520	missense	possibly damaging	0.81
R5037:Ncstn	UTSW	1	172068626	missense	probably damaging	1.00
R5150:Ncstn	UTSW	1	172067584	intron	probably benign
R5406:Ncstn	UTSW	1	172072164	missense	probably benign	0.00
R5444:Ncstn	UTSW	1	172072839	missense	possibly damaging	0.92
R5605:Ncstn	UTSW	1	172081150	intron	probably benign
R6675:Ncstn	UTSW	1	172071528	missense	probably damaging	1.00
R7268:Ncstn	UTSW	1	172081263	missense	possibly damaging	0.86
R7290:Ncstn	UTSW	1	172072806	missense	probably benign
R7871:Ncstn	UTSW	1	172075456	missense	probably benign	0.00
R8238:Ncstn	UTSW	1	172072476	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCTGGGGACAAATGAGCAAC -3'
(R):5'- TGGGATGAAGAGTTGCAGCC -3'

Sequencing Primer
(F):5'- CTGACAGACCACAGGCAGG -3'
(R):5'- TGAAGAGTTGCAGCCAGTTG -3'

Posted On

2015-04-17