Incidental Mutation 'R3946:Hoxd12'
ID 307687
Institutional Source Beutler Lab
Gene Symbol Hoxd12
Ensembl Gene ENSMUSG00000001823
Gene Name homeobox D12
Synonyms Hox-4.7, Hox-5.6
MMRRC Submission 040827-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.355) question?
Stock # R3946 (G1)
Quality Score 217
Status Validated
Chromosome 2
Chromosomal Location 74675013-74677705 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 74675427 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 114 (R114L)
Ref Sequence ENSEMBL: ENSMUSP00000001878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001872] [ENSMUST00000001878]
AlphaFold P23812
Predicted Effect probably benign
Transcript: ENSMUST00000001872
SMART Domains Protein: ENSMUSP00000001872
Gene: ENSMUSG00000001819

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
Pfam:HoxA13_N 75 177 4e-18 PFAM
HOX 272 334 4.33e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000001878
AA Change: R114L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000001878
Gene: ENSMUSG00000001823
AA Change: R114L

DomainStartEndE-ValueType
HOX 200 262 4.57e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000048086
Meta Mutation Damage Score 0.0847 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located in a cluster on chromosome 2. Deletions that remove the entire HOXD gene cluster or the 5' end of this cluster have been associated with severe limb and genital abnormalities. The exact role of this gene has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit minor forelimb defects affecting carpals, metacarpals, and phalanges, and alterations of smooth muscle layers of the rectum resulting in malformation of the internal anal sphincter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 T C 13: 64,309,098 I104V probably damaging Het
Abi2 A G 1: 60,453,754 Q328R probably damaging Het
Agr3 C A 12: 35,947,513 probably benign Het
Brca2 T A 5: 150,536,704 S481R probably damaging Het
Cabin1 T G 10: 75,745,259 Q411P probably damaging Het
Calr3 A G 8: 72,443,620 Y22H probably damaging Het
Caprin1 T A 2: 103,796,766 I59F probably damaging Het
Cdk5rap1 T C 2: 154,348,716 T442A probably damaging Het
Chn2 T C 6: 54,269,426 probably benign Het
Cic C A 7: 25,272,346 R501S possibly damaging Het
Coch A G 12: 51,601,812 probably null Het
Defa25 G A 8: 21,084,490 V17I probably null Het
Dglucy T C 12: 100,838,700 probably null Het
Dtx1 T G 5: 120,681,286 T616P possibly damaging Het
Eef1g T C 19: 8,969,977 L171P probably benign Het
Fam135a A G 1: 24,030,394 S465P probably damaging Het
Gm14025 A G 2: 129,039,601 L135P probably damaging Het
Gm14412 A T 2: 177,314,685 C472* probably null Het
Gm7104 T C 12: 88,286,042 noncoding transcript Het
Got2 A G 8: 95,888,230 S26P probably benign Het
H2-M11 A G 17: 36,549,231 I329M probably damaging Het
Hmcn2 T A 2: 31,382,394 D1295E possibly damaging Het
Ilkap A C 1: 91,387,250 D124E probably damaging Het
Med6 T C 12: 81,581,851 Y88C probably damaging Het
Mep1a A T 17: 43,475,041 L719* probably null Het
Mmp23 T C 4: 155,652,023 Y187C probably damaging Het
Myo1g A G 11: 6,520,760 M32T possibly damaging Het
Ncstn T C 1: 172,067,494 E614G probably benign Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr1309 G A 2: 111,983,297 T259M possibly damaging Het
Otub2 T A 12: 103,392,826 L58* probably null Het
Pcdhga12 G A 18: 37,767,629 V505I probably benign Het
Pcdhga9 T A 18: 37,737,844 V242D probably damaging Het
Pex1 C T 5: 3,626,084 L891F probably damaging Het
Pgm1 C T 5: 64,112,061 T497I probably benign Het
Pikfyve T C 1: 65,196,681 F171L probably damaging Het
Pilrb1 T G 5: 137,857,392 K79T probably benign Het
Pin1 C T 9: 20,655,364 R21W probably damaging Het
Ptprq A G 10: 107,686,392 probably benign Het
Rad17 G A 13: 100,622,863 A552V possibly damaging Het
Rbbp8 A G 18: 11,718,868 T249A probably benign Het
Rtkn A T 6: 83,135,976 I10F probably benign Het
Scube2 T A 7: 109,857,590 I103F possibly damaging Het
Sec23b A G 2: 144,581,973 H514R probably benign Het
Serbp1 T A 6: 67,272,220 D223E probably benign Het
Slc14a1 C A 18: 78,111,392 V260L probably benign Het
Slc22a23 A G 13: 34,183,126 I633T probably damaging Het
Stk19 A T 17: 34,824,747 probably benign Het
Svs2 T C 2: 164,237,127 M287V probably benign Het
Syne3 T A 12: 104,958,066 Q358L probably damaging Het
Synj1 A G 16: 91,010,096 F58L possibly damaging Het
Tg T C 15: 66,674,023 V198A probably damaging Het
Tle4 A T 19: 14,597,388 Y9N probably damaging Het
Tmem57 A G 4: 134,804,481 Y626H probably damaging Het
Tmx3 G A 18: 90,524,335 A186T possibly damaging Het
Traf3 G A 12: 111,255,245 S280N possibly damaging Het
Trmt13 A G 3: 116,581,518 F447S probably damaging Het
Trp53bp1 T A 2: 121,228,626 H918L probably damaging Het
Ush2a T G 1: 188,728,504 V2654G probably benign Het
Vmn2r25 A G 6: 123,840,098 Y175H probably damaging Het
Zfp335 T C 2: 164,892,189 D1330G probably damaging Het
Other mutations in Hoxd12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Hoxd12 APN 2 74675427 missense probably damaging 1.00
IGL01324:Hoxd12 APN 2 74675136 missense probably damaging 1.00
IGL02229:Hoxd12 APN 2 74675934 missense probably damaging 1.00
IGL02684:Hoxd12 APN 2 74675561 missense probably benign
R0661:Hoxd12 UTSW 2 74675892 missense probably damaging 0.98
R0975:Hoxd12 UTSW 2 74675934 missense probably damaging 1.00
R1931:Hoxd12 UTSW 2 74675513 missense probably benign
R1931:Hoxd12 UTSW 2 74675531 missense probably benign 0.00
R2510:Hoxd12 UTSW 2 74675471 missense possibly damaging 0.56
R2511:Hoxd12 UTSW 2 74675471 missense possibly damaging 0.56
R5194:Hoxd12 UTSW 2 74675103 missense probably damaging 1.00
R7326:Hoxd12 UTSW 2 74675246 missense possibly damaging 0.48
R7426:Hoxd12 UTSW 2 74675225 missense possibly damaging 0.82
R7972:Hoxd12 UTSW 2 74675925 missense probably damaging 1.00
R9138:Hoxd12 UTSW 2 74675558 missense probably benign 0.18
R9330:Hoxd12 UTSW 2 74675389 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTTCCAACCTGAGAGCCAATG -3'
(R):5'- TCAAGTTGAGCGGGCCTTTG -3'

Sequencing Primer
(F):5'- CCAATGGCAGCCAGTTGG -3'
(R):5'- GCCTTTGGTGTCTTCCTTGAAGC -3'
Posted On 2015-04-17