Incidental Mutation 'R3946:Olfr1309'
ID307689
Institutional Source Beutler Lab
Gene Symbol Olfr1309
Ensembl Gene ENSMUSG00000109528
Gene Nameolfactory receptor 1309
SynonymsMOR245-5, GA_x6K02T2Q125-73031456-73030518
MMRRC Submission 040827-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.343) question?
Stock #R3946 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111979857-111990281 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 111983297 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 259 (T259M)
Ref Sequence ENSEMBL: ENSMUSP00000150871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099604] [ENSMUST00000207885] [ENSMUST00000214537] [ENSMUST00000214935] [ENSMUST00000215045] [ENSMUST00000216948] [ENSMUST00000217452]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099604
AA Change: T267M

PolyPhen 2 Score 0.677 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097199
Gene: ENSMUSG00000094747
AA Change: T267M

DomainStartEndE-ValueType
Pfam:7tm_4 38 311 1.5e-36 PFAM
Pfam:7tm_1 49 295 6.5e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000207885
AA Change: T267M

PolyPhen 2 Score 0.677 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214537
AA Change: T259M

PolyPhen 2 Score 0.677 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214935
AA Change: T259M

PolyPhen 2 Score 0.677 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215045
AA Change: T259M

PolyPhen 2 Score 0.677 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216948
AA Change: T259M

PolyPhen 2 Score 0.677 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217452
AA Change: T259M

PolyPhen 2 Score 0.677 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 T C 13: 64,309,098 I104V probably damaging Het
Abi2 A G 1: 60,453,754 Q328R probably damaging Het
Agr3 C A 12: 35,947,513 probably benign Het
Brca2 T A 5: 150,536,704 S481R probably damaging Het
Cabin1 T G 10: 75,745,259 Q411P probably damaging Het
Calr3 A G 8: 72,443,620 Y22H probably damaging Het
Caprin1 T A 2: 103,796,766 I59F probably damaging Het
Cdk5rap1 T C 2: 154,348,716 T442A probably damaging Het
Chn2 T C 6: 54,269,426 probably benign Het
Cic C A 7: 25,272,346 R501S possibly damaging Het
Coch A G 12: 51,601,812 probably null Het
Defa25 G A 8: 21,084,490 V17I probably null Het
Dglucy T C 12: 100,838,700 probably null Het
Dtx1 T G 5: 120,681,286 T616P possibly damaging Het
Eef1g T C 19: 8,969,977 L171P probably benign Het
Fam135a A G 1: 24,030,394 S465P probably damaging Het
Gm14025 A G 2: 129,039,601 L135P probably damaging Het
Gm14412 A T 2: 177,314,685 C472* probably null Het
Gm7104 T C 12: 88,286,042 noncoding transcript Het
Got2 A G 8: 95,888,230 S26P probably benign Het
H2-M11 A G 17: 36,549,231 I329M probably damaging Het
Hmcn2 T A 2: 31,382,394 D1295E possibly damaging Het
Hoxd12 G T 2: 74,675,427 R114L probably damaging Het
Ilkap A C 1: 91,387,250 D124E probably damaging Het
Med6 T C 12: 81,581,851 Y88C probably damaging Het
Mep1a A T 17: 43,475,041 L719* probably null Het
Mmp23 T C 4: 155,652,023 Y187C probably damaging Het
Myo1g A G 11: 6,520,760 M32T possibly damaging Het
Ncstn T C 1: 172,067,494 E614G probably benign Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Otub2 T A 12: 103,392,826 L58* probably null Het
Pcdhga12 G A 18: 37,767,629 V505I probably benign Het
Pcdhga9 T A 18: 37,737,844 V242D probably damaging Het
Pex1 C T 5: 3,626,084 L891F probably damaging Het
Pgm1 C T 5: 64,112,061 T497I probably benign Het
Pikfyve T C 1: 65,196,681 F171L probably damaging Het
Pilrb1 T G 5: 137,857,392 K79T probably benign Het
Pin1 C T 9: 20,655,364 R21W probably damaging Het
Ptprq A G 10: 107,686,392 probably benign Het
Rad17 G A 13: 100,622,863 A552V possibly damaging Het
Rbbp8 A G 18: 11,718,868 T249A probably benign Het
Rtkn A T 6: 83,135,976 I10F probably benign Het
Scube2 T A 7: 109,857,590 I103F possibly damaging Het
Sec23b A G 2: 144,581,973 H514R probably benign Het
Serbp1 T A 6: 67,272,220 D223E probably benign Het
Slc14a1 C A 18: 78,111,392 V260L probably benign Het
Slc22a23 A G 13: 34,183,126 I633T probably damaging Het
Stk19 A T 17: 34,824,747 probably benign Het
Svs2 T C 2: 164,237,127 M287V probably benign Het
Syne3 T A 12: 104,958,066 Q358L probably damaging Het
Synj1 A G 16: 91,010,096 F58L possibly damaging Het
Tg T C 15: 66,674,023 V198A probably damaging Het
Tle4 A T 19: 14,597,388 Y9N probably damaging Het
Tmem57 A G 4: 134,804,481 Y626H probably damaging Het
Tmx3 G A 18: 90,524,335 A186T possibly damaging Het
Traf3 G A 12: 111,255,245 S280N possibly damaging Het
Trmt13 A G 3: 116,581,518 F447S probably damaging Het
Trp53bp1 T A 2: 121,228,626 H918L probably damaging Het
Ush2a T G 1: 188,728,504 V2654G probably benign Het
Vmn2r25 A G 6: 123,840,098 Y175H probably damaging Het
Zfp335 T C 2: 164,892,189 D1330G probably damaging Het
Other mutations in Olfr1309
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Olfr1309 APN 2 111983933 missense probably damaging 1.00
IGL02479:Olfr1309 APN 2 111983385 missense probably benign 0.35
R0234:Olfr1309 UTSW 2 111983300 missense probably damaging 0.99
R0234:Olfr1309 UTSW 2 111983300 missense probably damaging 0.99
R1777:Olfr1309 UTSW 2 111983697 missense possibly damaging 0.64
R1994:Olfr1309 UTSW 2 111984084 missense probably benign
R3892:Olfr1309 UTSW 2 111983141 missense probably benign 0.03
R4541:Olfr1309 UTSW 2 111983636 missense probably benign 0.01
R5150:Olfr1309 UTSW 2 111984021 missense probably benign 0.11
R5275:Olfr1309 UTSW 2 111983829 missense probably damaging 1.00
R5293:Olfr1309 UTSW 2 111983266 missense probably damaging 0.99
R6080:Olfr1309 UTSW 2 111983705 missense probably damaging 1.00
R6258:Olfr1309 UTSW 2 111984051 missense probably benign 0.05
R6260:Olfr1309 UTSW 2 111984051 missense probably benign 0.05
R6291:Olfr1309 UTSW 2 111983624 missense probably benign 0.00
R6442:Olfr1309 UTSW 2 111983529 missense probably damaging 0.99
R7013:Olfr1309 UTSW 2 111983963 missense probably benign 0.31
R7326:Olfr1309 UTSW 2 111983327 nonsense probably null
R7483:Olfr1309 UTSW 2 111983779 missense probably damaging 0.98
R8078:Olfr1309 UTSW 2 111983270 missense probably damaging 1.00
X0062:Olfr1309 UTSW 2 111983601 missense probably benign 0.00
Z1176:Olfr1309 UTSW 2 111983753 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGGTACCTTCTTTGAAATGTCCATG -3'
(R):5'- TCAACAGTGGGCTCATTTCTG -3'

Sequencing Primer
(F):5'- ACCTTCTTTGAAATGTCCATGATGGG -3'
(R):5'- GTGGGCTCCTTTCTTCTACTGG -3'
Posted On2015-04-17