Mutagenetix > Incidental Mutation

Incidental Mutation 'R3946:Zfp335'

307695

Institutional Source

Beutler Lab

Gene Symbol

Zfp335

Ensembl Gene

ENSMUSG00000039834

Gene Name

zinc finger protein 335

Synonyms

1810045J01Rik

MMRRC Submission

040827-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3946 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

164891882-164911757 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 164892189 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1330 (D1330G)

Ref Sequence

ENSEMBL: ENSMUSP00000038298 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041361] [ENSMUST00000041643] [ENSMUST00000183830]

AlphaFold

A2A5K6

Predicted Effect

probably damaging
Transcript: ENSMUST00000041361
AA Change: D1330G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000038298
Gene: ENSMUSG00000039834
AA Change: D1330G

Domain	Start	End	E-Value	Type
low complexity region	31	45	N/A	INTRINSIC
low complexity region	52	63	N/A	INTRINSIC
ZnF_C2H2	248	271	4.24e-4	SMART
low complexity region	275	282	N/A	INTRINSIC
low complexity region	300	321	N/A	INTRINSIC
low complexity region	340	365	N/A	INTRINSIC
low complexity region	435	445	N/A	INTRINSIC
ZnF_C2H2	466	488	2.17e-1	SMART
ZnF_C2H2	496	518	1.56e-2	SMART
ZnF_C2H2	524	546	8.81e-2	SMART
ZnF_C2H2	563	585	2.79e-4	SMART
ZnF_C2H2	591	613	2.53e-2	SMART
ZnF_C2H2	622	644	6.78e-3	SMART
ZnF_C2H2	650	673	8.22e-2	SMART
ZnF_C2H2	679	702	3.29e-1	SMART
low complexity region	711	726	N/A	INTRINSIC
internal_repeat_3	770	937	7.16e-5	PROSPERO
low complexity region	1005	1015	N/A	INTRINSIC
ZnF_C2H2	1019	1041	2.95e-3	SMART
ZnF_C2H2	1047	1069	5.5e-3	SMART
ZnF_C2H2	1075	1097	1.58e-3	SMART
ZnF_C2H2	1103	1126	3.34e-2	SMART
low complexity region	1288	1305	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000041643

SMART Domains

Protein: ENSMUSP00000039555
Gene: ENSMUSG00000039849

Domain	Start	End	E-Value	Type
WW	44	77	4.34e-4	SMART
low complexity region	132	148	N/A	INTRINSIC
Pfam:PCIF1_WW	445	620	7.1e-74	PFAM
low complexity region	675	686	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000183830

SMART Domains

Protein: ENSMUSP00000139133
Gene: ENSMUSG00000039834

Domain	Start	End	E-Value	Type
low complexity region	31	45	N/A	INTRINSIC
low complexity region	52	63	N/A	INTRINSIC
ZnF_C2H2	248	271	4.24e-4	SMART
low complexity region	275	282	N/A	INTRINSIC
low complexity region	300	321	N/A	INTRINSIC
low complexity region	340	365	N/A	INTRINSIC
low complexity region	435	445	N/A	INTRINSIC
ZnF_C2H2	466	488	2.17e-1	SMART
ZnF_C2H2	496	518	1.56e-2	SMART
ZnF_C2H2	524	546	8.81e-2	SMART
ZnF_C2H2	563	585	2.79e-4	SMART

Meta Mutation Damage Score

0.7414

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.1%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene enhances transcriptional activation by ligand-bound nuclear hormone receptors. However, it does this not by direct interaction with the receptor, but by direct interaction with the nuclear hormone receptor transcriptional coactivator NRC. The encoded protein may function by altering local chromatin structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality before implantation. Mice homozygous for a conditional allele activated in the brain exhibit loss of cortical neurons and decreased brain size. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaed1	T	C	13: 64,309,098	I104V	probably damaging	Het
Abi2	A	G	1: 60,453,754	Q328R	probably damaging	Het
Agr3	C	A	12: 35,947,513		probably benign	Het
Brca2	T	A	5: 150,536,704	S481R	probably damaging	Het
Cabin1	T	G	10: 75,745,259	Q411P	probably damaging	Het
Calr3	A	G	8: 72,443,620	Y22H	probably damaging	Het
Caprin1	T	A	2: 103,796,766	I59F	probably damaging	Het
Cdk5rap1	T	C	2: 154,348,716	T442A	probably damaging	Het
Chn2	T	C	6: 54,269,426		probably benign	Het
Cic	C	A	7: 25,272,346	R501S	possibly damaging	Het
Coch	A	G	12: 51,601,812		probably null	Het
Defa25	G	A	8: 21,084,490	V17I	probably null	Het
Dglucy	T	C	12: 100,838,700		probably null	Het
Dtx1	T	G	5: 120,681,286	T616P	possibly damaging	Het
Eef1g	T	C	19: 8,969,977	L171P	probably benign	Het
Fam135a	A	G	1: 24,030,394	S465P	probably damaging	Het
Gm14025	A	G	2: 129,039,601	L135P	probably damaging	Het
Gm14412	A	T	2: 177,314,685	C472*	probably null	Het
Gm7104	T	C	12: 88,286,042		noncoding transcript	Het
Got2	A	G	8: 95,888,230	S26P	probably benign	Het
H2-M11	A	G	17: 36,549,231	I329M	probably damaging	Het
Hmcn2	T	A	2: 31,382,394	D1295E	possibly damaging	Het
Hoxd12	G	T	2: 74,675,427	R114L	probably damaging	Het
Ilkap	A	C	1: 91,387,250	D124E	probably damaging	Het
Med6	T	C	12: 81,581,851	Y88C	probably damaging	Het
Mep1a	A	T	17: 43,475,041	L719*	probably null	Het
Mmp23	T	C	4: 155,652,023	Y187C	probably damaging	Het
Myo1g	A	G	11: 6,520,760	M32T	possibly damaging	Het
Ncstn	T	C	1: 172,067,494	E614G	probably benign	Het
Nr2c2	C	T	6: 92,163,138	R464W	probably damaging	Het
Olfr1309	G	A	2: 111,983,297	T259M	possibly damaging	Het
Otub2	T	A	12: 103,392,826	L58*	probably null	Het
Pcdhga12	G	A	18: 37,767,629	V505I	probably benign	Het
Pcdhga9	T	A	18: 37,737,844	V242D	probably damaging	Het
Pex1	C	T	5: 3,626,084	L891F	probably damaging	Het
Pgm1	C	T	5: 64,112,061	T497I	probably benign	Het
Pikfyve	T	C	1: 65,196,681	F171L	probably damaging	Het
Pilrb1	T	G	5: 137,857,392	K79T	probably benign	Het
Pin1	C	T	9: 20,655,364	R21W	probably damaging	Het
Ptprq	A	G	10: 107,686,392		probably benign	Het
Rad17	G	A	13: 100,622,863	A552V	possibly damaging	Het
Rbbp8	A	G	18: 11,718,868	T249A	probably benign	Het
Rtkn	A	T	6: 83,135,976	I10F	probably benign	Het
Scube2	T	A	7: 109,857,590	I103F	possibly damaging	Het
Sec23b	A	G	2: 144,581,973	H514R	probably benign	Het
Serbp1	T	A	6: 67,272,220	D223E	probably benign	Het
Slc14a1	C	A	18: 78,111,392	V260L	probably benign	Het
Slc22a23	A	G	13: 34,183,126	I633T	probably damaging	Het
Stk19	A	T	17: 34,824,747		probably benign	Het
Svs2	T	C	2: 164,237,127	M287V	probably benign	Het
Syne3	T	A	12: 104,958,066	Q358L	probably damaging	Het
Synj1	A	G	16: 91,010,096	F58L	possibly damaging	Het
Tg	T	C	15: 66,674,023	V198A	probably damaging	Het
Tle4	A	T	19: 14,597,388	Y9N	probably damaging	Het
Tmem57	A	G	4: 134,804,481	Y626H	probably damaging	Het
Tmx3	G	A	18: 90,524,335	A186T	possibly damaging	Het
Traf3	G	A	12: 111,255,245	S280N	possibly damaging	Het
Trmt13	A	G	3: 116,581,518	F447S	probably damaging	Het
Trp53bp1	T	A	2: 121,228,626	H918L	probably damaging	Het
Ush2a	T	G	1: 188,728,504	V2654G	probably benign	Het
Vmn2r25	A	G	6: 123,840,098	Y175H	probably damaging	Het

Other mutations in Zfp335

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Zfp335	APN	2	164892382	missense	probably damaging	1.00
IGL00921:Zfp335	APN	2	164894776	missense	possibly damaging	0.51
IGL00980:Zfp335	APN	2	164902674	nonsense	probably null
IGL01145:Zfp335	APN	2	164907502	missense	probably benign	0.03
IGL01568:Zfp335	APN	2	164894788	missense	possibly damaging	0.70
IGL01612:Zfp335	APN	2	164910620	critical splice donor site	probably null
IGL02138:Zfp335	APN	2	164893804	missense	probably damaging	1.00
IGL02675:Zfp335	APN	2	164910689	missense	probably benign
IGL03206:Zfp335	APN	2	164892681	splice site	probably benign
IGL03269:Zfp335	APN	2	164900354	missense	probably damaging	1.00
IGL03306:Zfp335	APN	2	164895984	splice site	probably benign
FR4342:Zfp335	UTSW	2	164907465	small insertion	probably benign
FR4342:Zfp335	UTSW	2	164907477	small insertion	probably benign
FR4449:Zfp335	UTSW	2	164907477	small insertion	probably benign
FR4449:Zfp335	UTSW	2	164907483	small insertion	probably benign
FR4548:Zfp335	UTSW	2	164907472	small insertion	probably benign
FR4737:Zfp335	UTSW	2	164907474	small insertion	probably benign
FR4737:Zfp335	UTSW	2	164907475	small insertion	probably benign
FR4737:Zfp335	UTSW	2	164907484	small insertion	probably benign
FR4976:Zfp335	UTSW	2	164907474	small insertion	probably benign
FR4976:Zfp335	UTSW	2	164907478	small insertion	probably benign
PIT4403001:Zfp335	UTSW	2	164893716	missense	possibly damaging	0.56
R0005:Zfp335	UTSW	2	164909302	missense	possibly damaging	0.91
R0101:Zfp335	UTSW	2	164899990	missense	probably damaging	1.00
R0196:Zfp335	UTSW	2	164896145	missense	possibly damaging	0.88
R0211:Zfp335	UTSW	2	164907692	missense	probably damaging	1.00
R0211:Zfp335	UTSW	2	164907692	missense	probably damaging	1.00
R0533:Zfp335	UTSW	2	164907922	nonsense	probably null
R0865:Zfp335	UTSW	2	164899495	splice site	probably null
R1023:Zfp335	UTSW	2	164892585	missense	possibly damaging	0.88
R1029:Zfp335	UTSW	2	164892678	splice site	probably benign
R1052:Zfp335	UTSW	2	164907468	small deletion	probably benign
R1106:Zfp335	UTSW	2	164907551	small deletion	probably benign
R1146:Zfp335	UTSW	2	164896123	missense	probably benign	0.01
R1146:Zfp335	UTSW	2	164896123	missense	probably benign	0.01
R1274:Zfp335	UTSW	2	164907468	small deletion	probably benign
R1386:Zfp335	UTSW	2	164898241	missense	probably benign	0.00
R1433:Zfp335	UTSW	2	164899456	missense	probably damaging	0.99
R1813:Zfp335	UTSW	2	164892605	missense	probably damaging	0.99
R1959:Zfp335	UTSW	2	164894802	missense	probably damaging	1.00
R2372:Zfp335	UTSW	2	164895039	missense	probably damaging	1.00
R3847:Zfp335	UTSW	2	164900106	splice site	probably null
R3937:Zfp335	UTSW	2	164910700	missense	probably damaging	1.00
R3979:Zfp335	UTSW	2	164910638	missense	probably benign	0.00
R4019:Zfp335	UTSW	2	164901460	missense	probably damaging	1.00
R4020:Zfp335	UTSW	2	164901460	missense	probably damaging	1.00
R4668:Zfp335	UTSW	2	164900286	missense	probably damaging	1.00
R5000:Zfp335	UTSW	2	164894668	missense	probably benign
R5038:Zfp335	UTSW	2	164910644	nonsense	probably null
R5245:Zfp335	UTSW	2	164894758	missense	probably benign
R5411:Zfp335	UTSW	2	164902245	missense	probably damaging	0.99
R5422:Zfp335	UTSW	2	164907730	missense	probably damaging	1.00
R5968:Zfp335	UTSW	2	164892394	missense	probably damaging	0.99
R6056:Zfp335	UTSW	2	164895098	splice site	probably null
R6551:Zfp335	UTSW	2	164909365	missense	probably benign
R6927:Zfp335	UTSW	2	164893720	missense	probably damaging	1.00
R6943:Zfp335	UTSW	2	164894875	missense	possibly damaging	0.50
R6995:Zfp335	UTSW	2	164893290	nonsense	probably null
R7174:Zfp335	UTSW	2	164902503	missense	probably damaging	1.00
R7185:Zfp335	UTSW	2	164893244	critical splice donor site	probably null
R7296:Zfp335	UTSW	2	164900132	missense	probably damaging	0.99
R7322:Zfp335	UTSW	2	164910821	start codon destroyed	probably null	0.90
R7504:Zfp335	UTSW	2	164909418	missense	probably benign	0.27
R7560:Zfp335	UTSW	2	164895992	missense	probably damaging	1.00
R7637:Zfp335	UTSW	2	164892539	critical splice donor site	probably null
R8064:Zfp335	UTSW	2	164907700	missense	probably damaging	1.00
R8208:Zfp335	UTSW	2	164893616	critical splice acceptor site	probably null
R8228:Zfp335	UTSW	2	164904898	missense	probably damaging	1.00
R8271:Zfp335	UTSW	2	164898053	missense	probably damaging	0.98
R8688:Zfp335	UTSW	2	164892193	missense	probably damaging	1.00
R8803:Zfp335	UTSW	2	164909370	missense	probably benign	0.14
R9266:Zfp335	UTSW	2	164896087	missense	probably benign	0.33
R9352:Zfp335	UTSW	2	164900322	missense	probably damaging	0.99
R9487:Zfp335	UTSW	2	164893475	missense	probably damaging	0.99
R9752:Zfp335	UTSW	2	164907427	critical splice donor site	probably null
RF031:Zfp335	UTSW	2	164907463	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- AAATTTCTCTCCCAAAGCCTGC -3'
(R):5'- TATGGACCGGATACTGCCAG -3'

Sequencing Primer
(F):5'- GCACCCAGCATGTCCTG -3'
(R):5'- ATACTGCCAGCCAGGAGC -3'

Posted On

2015-04-17