Incidental Mutation 'R3946:Trmt13'
ID307696
Institutional Source Beutler Lab
Gene Symbol Trmt13
Ensembl Gene ENSMUSG00000033439
Gene NametRNA methyltransferase 13
Synonyms
MMRRC Submission 040827-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R3946 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location116581093-116614587 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116581518 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 447 (F447S)
Ref Sequence ENSEMBL: ENSMUSP00000047320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029573] [ENSMUST00000041524] [ENSMUST00000183638] [ENSMUST00000184963] [ENSMUST00000197190]
Predicted Effect probably benign
Transcript: ENSMUST00000029573
SMART Domains Protein: ENSMUSP00000029573
Gene: ENSMUSG00000027961

DomainStartEndE-ValueType
LRR 105 127 1.15e1 SMART
LRR_TYP 128 151 7.26e-3 SMART
LRR 175 197 6.58e0 SMART
LRR 198 220 1e1 SMART
LRR 221 243 7.16e0 SMART
LRR 244 267 6.58e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000041524
AA Change: F447S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000047320
Gene: ENSMUSG00000033439
AA Change: F447S

DomainStartEndE-ValueType
Pfam:zf-TRM13_CCCH 17 45 7.2e-17 PFAM
Pfam:zf-U11-48K 56 80 3.4e-12 PFAM
Pfam:TRM13 165 469 7e-96 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156161
Predicted Effect probably benign
Transcript: ENSMUST00000183638
SMART Domains Protein: ENSMUSP00000139223
Gene: ENSMUSG00000033439

DomainStartEndE-ValueType
Pfam:zf-TRM13_CCCH 16 46 1.4e-17 PFAM
Pfam:zf-U11-48K 55 81 1.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184963
SMART Domains Protein: ENSMUSP00000138868
Gene: ENSMUSG00000033439

DomainStartEndE-ValueType
Pfam:zf-TRM13_CCCH 16 46 2.9e-17 PFAM
Pfam:zf-U11-48K 55 81 2.3e-12 PFAM
Pfam:TRM13 165 285 3.4e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197190
SMART Domains Protein: ENSMUSP00000143637
Gene: ENSMUSG00000033439

DomainStartEndE-ValueType
Pfam:TRM13 116 179 5.2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199439
Meta Mutation Damage Score 0.9095 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 T C 13: 64,309,098 I104V probably damaging Het
Abi2 A G 1: 60,453,754 Q328R probably damaging Het
Agr3 C A 12: 35,947,513 probably benign Het
Brca2 T A 5: 150,536,704 S481R probably damaging Het
Cabin1 T G 10: 75,745,259 Q411P probably damaging Het
Calr3 A G 8: 72,443,620 Y22H probably damaging Het
Caprin1 T A 2: 103,796,766 I59F probably damaging Het
Cdk5rap1 T C 2: 154,348,716 T442A probably damaging Het
Chn2 T C 6: 54,269,426 probably benign Het
Cic C A 7: 25,272,346 R501S possibly damaging Het
Coch A G 12: 51,601,812 probably null Het
Defa25 G A 8: 21,084,490 V17I probably null Het
Dglucy T C 12: 100,838,700 probably null Het
Dtx1 T G 5: 120,681,286 T616P possibly damaging Het
Eef1g T C 19: 8,969,977 L171P probably benign Het
Fam135a A G 1: 24,030,394 S465P probably damaging Het
Gm14025 A G 2: 129,039,601 L135P probably damaging Het
Gm14412 A T 2: 177,314,685 C472* probably null Het
Gm7104 T C 12: 88,286,042 noncoding transcript Het
Got2 A G 8: 95,888,230 S26P probably benign Het
H2-M11 A G 17: 36,549,231 I329M probably damaging Het
Hmcn2 T A 2: 31,382,394 D1295E possibly damaging Het
Hoxd12 G T 2: 74,675,427 R114L probably damaging Het
Ilkap A C 1: 91,387,250 D124E probably damaging Het
Med6 T C 12: 81,581,851 Y88C probably damaging Het
Mep1a A T 17: 43,475,041 L719* probably null Het
Mmp23 T C 4: 155,652,023 Y187C probably damaging Het
Myo1g A G 11: 6,520,760 M32T possibly damaging Het
Ncstn T C 1: 172,067,494 E614G probably benign Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr1309 G A 2: 111,983,297 T259M possibly damaging Het
Otub2 T A 12: 103,392,826 L58* probably null Het
Pcdhga12 G A 18: 37,767,629 V505I probably benign Het
Pcdhga9 T A 18: 37,737,844 V242D probably damaging Het
Pex1 C T 5: 3,626,084 L891F probably damaging Het
Pgm1 C T 5: 64,112,061 T497I probably benign Het
Pikfyve T C 1: 65,196,681 F171L probably damaging Het
Pilrb1 T G 5: 137,857,392 K79T probably benign Het
Pin1 C T 9: 20,655,364 R21W probably damaging Het
Ptprq A G 10: 107,686,392 probably benign Het
Rad17 G A 13: 100,622,863 A552V possibly damaging Het
Rbbp8 A G 18: 11,718,868 T249A probably benign Het
Rtkn A T 6: 83,135,976 I10F probably benign Het
Scube2 T A 7: 109,857,590 I103F possibly damaging Het
Sec23b A G 2: 144,581,973 H514R probably benign Het
Serbp1 T A 6: 67,272,220 D223E probably benign Het
Slc14a1 C A 18: 78,111,392 V260L probably benign Het
Slc22a23 A G 13: 34,183,126 I633T probably damaging Het
Stk19 A T 17: 34,824,747 probably benign Het
Svs2 T C 2: 164,237,127 M287V probably benign Het
Syne3 T A 12: 104,958,066 Q358L probably damaging Het
Synj1 A G 16: 91,010,096 F58L possibly damaging Het
Tg T C 15: 66,674,023 V198A probably damaging Het
Tle4 A T 19: 14,597,388 Y9N probably damaging Het
Tmem57 A G 4: 134,804,481 Y626H probably damaging Het
Tmx3 G A 18: 90,524,335 A186T possibly damaging Het
Traf3 G A 12: 111,255,245 S280N possibly damaging Het
Trp53bp1 T A 2: 121,228,626 H918L probably damaging Het
Ush2a T G 1: 188,728,504 V2654G probably benign Het
Vmn2r25 A G 6: 123,840,098 Y175H probably damaging Het
Zfp335 T C 2: 164,892,189 D1330G probably damaging Het
Other mutations in Trmt13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Trmt13 APN 3 116590235 nonsense probably null
IGL01516:Trmt13 APN 3 116589810 unclassified probably benign
IGL01732:Trmt13 APN 3 116581464 missense probably damaging 1.00
IGL01783:Trmt13 APN 3 116582912 nonsense probably null
IGL02470:Trmt13 APN 3 116590228 critical splice donor site probably null
IGL02492:Trmt13 APN 3 116582543 missense possibly damaging 0.53
IGL02531:Trmt13 APN 3 116592191 critical splice donor site probably null
IGL03156:Trmt13 APN 3 116585802 missense probably benign 0.00
R0394:Trmt13 UTSW 3 116582650 missense probably damaging 1.00
R0446:Trmt13 UTSW 3 116582626 missense probably damaging 1.00
R2211:Trmt13 UTSW 3 116594754 missense probably benign 0.00
R2942:Trmt13 UTSW 3 116585772 missense probably damaging 1.00
R3124:Trmt13 UTSW 3 116590244 missense probably benign 0.00
R3945:Trmt13 UTSW 3 116581518 missense probably damaging 1.00
R4255:Trmt13 UTSW 3 116582688 nonsense probably null
R4520:Trmt13 UTSW 3 116581613 splice site probably null
R4609:Trmt13 UTSW 3 116594827 utr 5 prime probably benign
R4678:Trmt13 UTSW 3 116589755 missense probably damaging 1.00
R4679:Trmt13 UTSW 3 116589755 missense probably damaging 1.00
R4703:Trmt13 UTSW 3 116594598 missense probably benign 0.00
R6526:Trmt13 UTSW 3 116592215 missense probably damaging 1.00
R7064:Trmt13 UTSW 3 116582697 missense probably damaging 1.00
R7079:Trmt13 UTSW 3 116582831 missense probably benign 0.00
R7308:Trmt13 UTSW 3 116594739 missense probably benign 0.09
R8347:Trmt13 UTSW 3 116582768 missense probably benign 0.00
R8491:Trmt13 UTSW 3 116582579 missense probably benign
R8544:Trmt13 UTSW 3 116592445 splice site probably null
Predicted Primers PCR Primer
(F):5'- GAGCCCTGCTGAAAAGGAATAC -3'
(R):5'- GCTTCGTAAATGGCAGTGG -3'

Sequencing Primer
(F):5'- GAAGACAAACGTCACGTTC -3'
(R):5'- GTGGCCAAACTTGGTATG -3'
Posted On2015-04-17