Incidental Mutation 'R3946:Mmp23'
ID 307698
Institutional Source Beutler Lab
Gene Symbol Mmp23
Ensembl Gene ENSMUSG00000029061
Gene Name matrix metallopeptidase 23
Synonyms CA-MMP, cysteine array matrix metalloproteinase
MMRRC Submission 040827-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3946 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 155735112-155737841 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 155736480 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 187 (Y187C)
Ref Sequence ENSEMBL: ENSMUSP00000030937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030937] [ENSMUST00000067081] [ENSMUST00000103176] [ENSMUST00000105598] [ENSMUST00000105600] [ENSMUST00000141108]
AlphaFold O88676
Predicted Effect probably damaging
Transcript: ENSMUST00000030937
AA Change: Y187C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030937
Gene: ENSMUSG00000029061
AA Change: Y187C

DomainStartEndE-ValueType
low complexity region 19 41 N/A INTRINSIC
ZnMc 85 256 8.39e-48 SMART
ShKT 255 291 4.06e-10 SMART
IG 307 390 4.53e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067081
SMART Domains Protein: ENSMUSP00000070527
Gene: ENSMUSG00000029062

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
low complexity region 93 112 N/A INTRINSIC
coiled coil region 123 214 N/A INTRINSIC
low complexity region 252 259 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
coiled coil region 290 337 N/A INTRINSIC
low complexity region 369 383 N/A INTRINSIC
S_TKc 427 712 5.05e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103176
SMART Domains Protein: ENSMUSP00000099465
Gene: ENSMUSG00000029060

DomainStartEndE-ValueType
Pfam:MIB_HERC2 12 78 3.4e-26 PFAM
ZnF_ZZ 85 130 6.44e-9 SMART
Pfam:MIB_HERC2 160 225 4.2e-26 PFAM
Blast:ANK 285 320 2e-13 BLAST
ANK 428 457 8.52e-4 SMART
ANK 461 490 6.71e-2 SMART
ANK 494 523 9.93e-5 SMART
ANK 527 559 1.1e2 SMART
ANK 563 593 9.21e0 SMART
ANK 597 627 3.57e-6 SMART
ANK 631 660 3.31e-1 SMART
ANK 664 709 1.73e3 SMART
Blast:ANK 733 762 9e-10 BLAST
low complexity region 763 772 N/A INTRINSIC
RING 798 832 2.55e-1 SMART
RING 877 909 1.81e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105598
SMART Domains Protein: ENSMUSP00000101223
Gene: ENSMUSG00000029062

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 59 78 N/A INTRINSIC
coiled coil region 89 180 N/A INTRINSIC
low complexity region 218 225 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
coiled coil region 256 303 N/A INTRINSIC
low complexity region 335 349 N/A INTRINSIC
S_TKc 393 678 5.05e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105600
SMART Domains Protein: ENSMUSP00000101225
Gene: ENSMUSG00000029062

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
low complexity region 93 112 N/A INTRINSIC
coiled coil region 123 214 N/A INTRINSIC
low complexity region 252 259 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
coiled coil region 290 337 N/A INTRINSIC
low complexity region 369 383 N/A INTRINSIC
S_TKc 427 712 5.05e-93 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155100
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139134
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151843
Predicted Effect probably benign
Transcript: ENSMUST00000141108
SMART Domains Protein: ENSMUSP00000122269
Gene: ENSMUSG00000029060

DomainStartEndE-ValueType
Pfam:MIB_HERC2 1 52 7.1e-17 PFAM
internal_repeat_1 82 150 7.77e-12 PROSPERO
internal_repeat_1 153 220 7.77e-12 PROSPERO
ANK 289 318 8.52e-4 SMART
ANK 322 351 6.71e-2 SMART
Pfam:Ank 356 375 2.9e-4 PFAM
Meta Mutation Damage Score 0.3993 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded protein contains an N-terminal cysteine array and a novel immunoglobulin-fold domain at the C-terminus. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing. [provided by RefSeq, Feb 2016]
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi2 A G 1: 60,492,913 (GRCm39) Q328R probably damaging Het
Agr3 C A 12: 35,997,512 (GRCm39) probably benign Het
Brca2 T A 5: 150,460,169 (GRCm39) S481R probably damaging Het
Cabin1 T G 10: 75,581,093 (GRCm39) Q411P probably damaging Het
Calr3 A G 8: 73,197,464 (GRCm39) Y22H probably damaging Het
Caprin1 T A 2: 103,627,111 (GRCm39) I59F probably damaging Het
Cdk5rap1 T C 2: 154,190,636 (GRCm39) T442A probably damaging Het
Chn2 T C 6: 54,246,411 (GRCm39) probably benign Het
Cic C A 7: 24,971,771 (GRCm39) R501S possibly damaging Het
Coch A G 12: 51,648,595 (GRCm39) probably null Het
Defa25 G A 8: 21,574,506 (GRCm39) V17I probably null Het
Dglucy T C 12: 100,804,959 (GRCm39) probably null Het
Dtx1 T G 5: 120,819,351 (GRCm39) T616P possibly damaging Het
Eef1g T C 19: 8,947,341 (GRCm39) L171P probably benign Het
Fam135a A G 1: 24,069,475 (GRCm39) S465P probably damaging Het
Gm14412 A T 2: 177,006,478 (GRCm39) C472* probably null Het
Gm7104 T C 12: 88,252,812 (GRCm39) noncoding transcript Het
Got2 A G 8: 96,614,858 (GRCm39) S26P probably benign Het
H2-M11 A G 17: 36,860,123 (GRCm39) I329M probably damaging Het
Hmcn2 T A 2: 31,272,406 (GRCm39) D1295E possibly damaging Het
Hoxd12 G T 2: 74,505,771 (GRCm39) R114L probably damaging Het
Ilkap A C 1: 91,314,972 (GRCm39) D124E probably damaging Het
Maco1 A G 4: 134,531,792 (GRCm39) Y626H probably damaging Het
Med6 T C 12: 81,628,625 (GRCm39) Y88C probably damaging Het
Mep1a A T 17: 43,785,932 (GRCm39) L719* probably null Het
Myo1g A G 11: 6,470,760 (GRCm39) M32T possibly damaging Het
Ncstn T C 1: 171,895,061 (GRCm39) E614G probably benign Het
Nr2c2 C T 6: 92,140,119 (GRCm39) R464W probably damaging Het
Or4f15 G A 2: 111,813,642 (GRCm39) T259M possibly damaging Het
Otub2 T A 12: 103,359,085 (GRCm39) L58* probably null Het
Pcdhga12 G A 18: 37,900,682 (GRCm39) V505I probably benign Het
Pcdhga9 T A 18: 37,870,897 (GRCm39) V242D probably damaging Het
Pex1 C T 5: 3,676,084 (GRCm39) L891F probably damaging Het
Pgm2 C T 5: 64,269,404 (GRCm39) T497I probably benign Het
Pikfyve T C 1: 65,235,840 (GRCm39) F171L probably damaging Het
Pilrb1 T G 5: 137,855,654 (GRCm39) K79T probably benign Het
Pin1 C T 9: 20,566,660 (GRCm39) R21W probably damaging Het
Prxl2c T C 13: 64,456,912 (GRCm39) I104V probably damaging Het
Ptprq A G 10: 107,522,253 (GRCm39) probably benign Het
Rad17 G A 13: 100,759,371 (GRCm39) A552V possibly damaging Het
Rbbp8 A G 18: 11,851,925 (GRCm39) T249A probably benign Het
Rtkn A T 6: 83,112,957 (GRCm39) I10F probably benign Het
Scube2 T A 7: 109,456,797 (GRCm39) I103F possibly damaging Het
Sec23b A G 2: 144,423,893 (GRCm39) H514R probably benign Het
Serbp1 T A 6: 67,249,204 (GRCm39) D223E probably benign Het
Slc14a1 C A 18: 78,154,607 (GRCm39) V260L probably benign Het
Slc22a23 A G 13: 34,367,109 (GRCm39) I633T probably damaging Het
Stk19 A T 17: 35,043,723 (GRCm39) probably benign Het
Svs5 T C 2: 164,079,047 (GRCm39) M287V probably benign Het
Syne3 T A 12: 104,924,325 (GRCm39) Q358L probably damaging Het
Synj1 A G 16: 90,806,984 (GRCm39) F58L possibly damaging Het
Tg T C 15: 66,545,872 (GRCm39) V198A probably damaging Het
Tle4 A T 19: 14,574,752 (GRCm39) Y9N probably damaging Het
Tmx3 G A 18: 90,542,459 (GRCm39) A186T possibly damaging Het
Traf3 G A 12: 111,221,679 (GRCm39) S280N possibly damaging Het
Trmt13 A G 3: 116,375,167 (GRCm39) F447S probably damaging Het
Trp53bp1 T A 2: 121,059,107 (GRCm39) H918L probably damaging Het
Ush2a T G 1: 188,460,701 (GRCm39) V2654G probably benign Het
Vinac1 A G 2: 128,881,521 (GRCm39) L135P probably damaging Het
Vmn2r25 A G 6: 123,817,057 (GRCm39) Y175H probably damaging Het
Zfp335 T C 2: 164,734,109 (GRCm39) D1330G probably damaging Het
Other mutations in Mmp23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Mmp23 APN 4 155,735,464 (GRCm39) missense possibly damaging 0.67
IGL02749:Mmp23 APN 4 155,735,989 (GRCm39) missense possibly damaging 0.65
R0030:Mmp23 UTSW 4 155,735,768 (GRCm39) nonsense probably null
R0173:Mmp23 UTSW 4 155,735,222 (GRCm39) missense possibly damaging 0.82
R0244:Mmp23 UTSW 4 155,736,589 (GRCm39) missense probably damaging 1.00
R1521:Mmp23 UTSW 4 155,735,174 (GRCm39) missense possibly damaging 0.92
R1696:Mmp23 UTSW 4 155,735,166 (GRCm39) makesense probably null
R1957:Mmp23 UTSW 4 155,736,509 (GRCm39) missense possibly damaging 0.96
R2055:Mmp23 UTSW 4 155,736,444 (GRCm39) missense possibly damaging 0.76
R4170:Mmp23 UTSW 4 155,735,767 (GRCm39) missense probably damaging 0.99
R5153:Mmp23 UTSW 4 155,735,797 (GRCm39) missense probably damaging 1.00
R5660:Mmp23 UTSW 4 155,735,710 (GRCm39) missense probably damaging 1.00
R6193:Mmp23 UTSW 4 155,735,990 (GRCm39) missense possibly damaging 0.90
R6480:Mmp23 UTSW 4 155,736,798 (GRCm39) missense probably damaging 1.00
R7426:Mmp23 UTSW 4 155,736,041 (GRCm39) missense probably damaging 1.00
R7979:Mmp23 UTSW 4 155,736,462 (GRCm39) missense possibly damaging 0.90
R9500:Mmp23 UTSW 4 155,736,567 (GRCm39) missense probably benign 0.17
R9545:Mmp23 UTSW 4 155,735,980 (GRCm39) missense probably benign 0.00
R9757:Mmp23 UTSW 4 155,735,515 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGAGACCCAGTGTTCCTC -3'
(R):5'- TCCCAGTGACCTCAAGATAGG -3'

Sequencing Primer
(F):5'- GAGACCCAGTGTTCCTCTTCCTTG -3'
(R):5'- TGGGTAACTGAAGAGCTCCC -3'
Posted On 2015-04-17