Mutagenetix > Incidental Mutation

Incidental Mutation 'R3946:Pex1'

307699

Institutional Source

Beutler Lab

Gene Symbol

Pex1

Ensembl Gene

ENSMUSG00000005907

Gene Name

peroxisomal biogenesis factor 1

Synonyms

peroxisome biogenesis factor 1, ZWS1

MMRRC Submission

040827-MU

Accession Numbers

Genbank: NM_027777

Essential gene?

Possibly essential (E-score: 0.649) question?

Stock #

R3946 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3596066-3637232 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 3626084 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 891 (L891F)

Ref Sequence

ENSEMBL: ENSMUSP00000113304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006061] [ENSMUST00000121291] [ENSMUST00000143132] [ENSMUST00000195894]

AlphaFold

Q5BL07

Predicted Effect

probably damaging
Transcript: ENSMUST00000006061
AA Change: L851F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000006061
Gene: ENSMUSG00000005907
AA Change: L851F

Domain	Start	End	E-Value	Type
Pfam:PEX-2N	14	99	2.4e-53	PFAM
Pfam:PEX-1N	103	179	8.6e-27	PFAM
low complexity region	508	527	N/A	INTRINSIC
AAA	552	702	1.39e-10	SMART
low complexity region	754	765	N/A	INTRINSIC
AAA	834	970	4.07e-17	SMART
low complexity region	1024	1044	N/A	INTRINSIC
low complexity region	1051	1061	N/A	INTRINSIC
low complexity region	1065	1078	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000121291
AA Change: L891F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113304
Gene: ENSMUSG00000005907
AA Change: L891F

Domain	Start	End	E-Value	Type
Pfam:PEX-2N	17	98	8.7e-38	PFAM
Pfam:PEX-1N	104	179	1.4e-27	PFAM
low complexity region	548	567	N/A	INTRINSIC
AAA	592	742	1.39e-10	SMART
low complexity region	794	805	N/A	INTRINSIC
AAA	874	1010	4.07e-17	SMART
low complexity region	1064	1084	N/A	INTRINSIC
low complexity region	1091	1101	N/A	INTRINSIC
low complexity region	1105	1118	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000143132

SMART Domains

Protein: ENSMUSP00000116645
Gene: ENSMUSG00000005907

Domain	Start	End	E-Value	Type
Blast:AAA	1	68	7e-31	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000195894

SMART Domains

Protein: ENSMUSP00000142620
Gene: ENSMUSG00000005907

Domain	Start	End	E-Value	Type
Pfam:PEX-2N	14	99	2.5e-51	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196124

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196692

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199632

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199650

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.1%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA ATPase family, a large group of ATPases associated with diverse cellular activities. This protein is cytoplasmic but is often anchored to a peroxisomal membrane where it forms a heteromeric complex and plays a role in the import of proteins into peroxisomes and peroxisome biogenesis. Mutations in this gene have been associated with complementation group 1 peroxisomal disorders such as neonatal adrenoleukodystrophy, infantile Refsum disease, and Zellweger syndrome. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-in allele display premature death, postnatal growth retardation, fatty livers, a bile acid defect associated with intestinal lipid malabsorption and cholestasis, and a retinopathy associated with retinal cone cell degenerationand abnormal cone and rod electrophysiology. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, other(2) Gene trapped(2)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaed1	T	C	13: 64,309,098	I104V	probably damaging	Het
Abi2	A	G	1: 60,453,754	Q328R	probably damaging	Het
Agr3	C	A	12: 35,947,513		probably benign	Het
Brca2	T	A	5: 150,536,704	S481R	probably damaging	Het
Cabin1	T	G	10: 75,745,259	Q411P	probably damaging	Het
Calr3	A	G	8: 72,443,620	Y22H	probably damaging	Het
Caprin1	T	A	2: 103,796,766	I59F	probably damaging	Het
Cdk5rap1	T	C	2: 154,348,716	T442A	probably damaging	Het
Chn2	T	C	6: 54,269,426		probably benign	Het
Cic	C	A	7: 25,272,346	R501S	possibly damaging	Het
Coch	A	G	12: 51,601,812		probably null	Het
Defa25	G	A	8: 21,084,490	V17I	probably null	Het
Dglucy	T	C	12: 100,838,700		probably null	Het
Dtx1	T	G	5: 120,681,286	T616P	possibly damaging	Het
Eef1g	T	C	19: 8,969,977	L171P	probably benign	Het
Fam135a	A	G	1: 24,030,394	S465P	probably damaging	Het
Gm14025	A	G	2: 129,039,601	L135P	probably damaging	Het
Gm14412	A	T	2: 177,314,685	C472*	probably null	Het
Gm7104	T	C	12: 88,286,042		noncoding transcript	Het
Got2	A	G	8: 95,888,230	S26P	probably benign	Het
H2-M11	A	G	17: 36,549,231	I329M	probably damaging	Het
Hmcn2	T	A	2: 31,382,394	D1295E	possibly damaging	Het
Hoxd12	G	T	2: 74,675,427	R114L	probably damaging	Het
Ilkap	A	C	1: 91,387,250	D124E	probably damaging	Het
Med6	T	C	12: 81,581,851	Y88C	probably damaging	Het
Mep1a	A	T	17: 43,475,041	L719*	probably null	Het
Mmp23	T	C	4: 155,652,023	Y187C	probably damaging	Het
Myo1g	A	G	11: 6,520,760	M32T	possibly damaging	Het
Ncstn	T	C	1: 172,067,494	E614G	probably benign	Het
Nr2c2	C	T	6: 92,163,138	R464W	probably damaging	Het
Olfr1309	G	A	2: 111,983,297	T259M	possibly damaging	Het
Otub2	T	A	12: 103,392,826	L58*	probably null	Het
Pcdhga12	G	A	18: 37,767,629	V505I	probably benign	Het
Pcdhga9	T	A	18: 37,737,844	V242D	probably damaging	Het
Pgm1	C	T	5: 64,112,061	T497I	probably benign	Het
Pikfyve	T	C	1: 65,196,681	F171L	probably damaging	Het
Pilrb1	T	G	5: 137,857,392	K79T	probably benign	Het
Pin1	C	T	9: 20,655,364	R21W	probably damaging	Het
Ptprq	A	G	10: 107,686,392		probably benign	Het
Rad17	G	A	13: 100,622,863	A552V	possibly damaging	Het
Rbbp8	A	G	18: 11,718,868	T249A	probably benign	Het
Rtkn	A	T	6: 83,135,976	I10F	probably benign	Het
Scube2	T	A	7: 109,857,590	I103F	possibly damaging	Het
Sec23b	A	G	2: 144,581,973	H514R	probably benign	Het
Serbp1	T	A	6: 67,272,220	D223E	probably benign	Het
Slc14a1	C	A	18: 78,111,392	V260L	probably benign	Het
Slc22a23	A	G	13: 34,183,126	I633T	probably damaging	Het
Stk19	A	T	17: 34,824,747		probably benign	Het
Svs2	T	C	2: 164,237,127	M287V	probably benign	Het
Syne3	T	A	12: 104,958,066	Q358L	probably damaging	Het
Synj1	A	G	16: 91,010,096	F58L	possibly damaging	Het
Tg	T	C	15: 66,674,023	V198A	probably damaging	Het
Tle4	A	T	19: 14,597,388	Y9N	probably damaging	Het
Tmem57	A	G	4: 134,804,481	Y626H	probably damaging	Het
Tmx3	G	A	18: 90,524,335	A186T	possibly damaging	Het
Traf3	G	A	12: 111,255,245	S280N	possibly damaging	Het
Trmt13	A	G	3: 116,581,518	F447S	probably damaging	Het
Trp53bp1	T	A	2: 121,228,626	H918L	probably damaging	Het
Ush2a	T	G	1: 188,728,504	V2654G	probably benign	Het
Vmn2r25	A	G	6: 123,840,098	Y175H	probably damaging	Het
Zfp335	T	C	2: 164,892,189	D1330G	probably damaging	Het

Other mutations in Pex1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01287:Pex1	APN	5	3606027	missense	probably benign	0.00
IGL01315:Pex1	APN	5	3609975	missense	probably damaging	1.00
IGL01671:Pex1	APN	5	3624088	missense	probably benign	0.00
IGL01863:Pex1	APN	5	3606066	missense	probably benign	0.01
IGL01933:Pex1	APN	5	3633789	missense	probably damaging	1.00
IGL01960:Pex1	APN	5	3627588	unclassified	probably benign
IGL02347:Pex1	APN	5	3603350	missense	probably damaging	0.98
IGL02374:Pex1	APN	5	3635481	missense	probably benign	0.01
IGL02392:Pex1	APN	5	3605952	nonsense	probably null
IGL02597:Pex1	APN	5	3635865	missense	possibly damaging	0.50
IGL02703:Pex1	APN	5	3615120	missense	probably benign	0.24
IGL02815:Pex1	APN	5	3636797	missense	probably damaging	0.97
IGL02862:Pex1	APN	5	3605424	intron	probably benign
IGL03005:Pex1	APN	5	3630292	missense	probably null	0.96
E0370:Pex1	UTSW	5	3631614	splice site	probably null
F5493:Pex1	UTSW	5	3635912	critical splice donor site	probably null
R0014:Pex1	UTSW	5	3626141	unclassified	probably benign
R0014:Pex1	UTSW	5	3626141	unclassified	probably benign
R0401:Pex1	UTSW	5	3633759	missense	probably damaging	1.00
R0480:Pex1	UTSW	5	3606444	splice site	probably null
R0555:Pex1	UTSW	5	3606130	missense	possibly damaging	0.89
R0976:Pex1	UTSW	5	3633943	missense	probably benign	0.00
R1200:Pex1	UTSW	5	3606411	critical splice donor site	probably null
R1672:Pex1	UTSW	5	3626085	missense	probably damaging	1.00
R1753:Pex1	UTSW	5	3630044	missense	probably damaging	1.00
R1880:Pex1	UTSW	5	3605770	missense	probably benign
R1953:Pex1	UTSW	5	3630038	missense	probably damaging	1.00
R2054:Pex1	UTSW	5	3603341	missense	possibly damaging	0.78
R2081:Pex1	UTSW	5	3624132	critical splice donor site	probably null
R2237:Pex1	UTSW	5	3618915	critical splice donor site	probably null
R4528:Pex1	UTSW	5	3631712	missense	probably damaging	1.00
R4579:Pex1	UTSW	5	3618880	missense	probably benign	0.03
R4585:Pex1	UTSW	5	3633885	missense	probably damaging	1.00
R4586:Pex1	UTSW	5	3633885	missense	probably damaging	1.00
R4656:Pex1	UTSW	5	3604880	critical splice donor site	probably null
R4789:Pex1	UTSW	5	3630270	missense	probably damaging	0.98
R4850:Pex1	UTSW	5	3624426	missense	probably benign
R4963:Pex1	UTSW	5	3609924	missense	probably benign	0.01
R5005:Pex1	UTSW	5	3622310	missense	probably damaging	1.00
R5015:Pex1	UTSW	5	3620597	missense	probably damaging	1.00
R5019:Pex1	UTSW	5	3622331	missense	probably damaging	1.00
R5937:Pex1	UTSW	5	3624487	missense	possibly damaging	0.94
R5942:Pex1	UTSW	5	3610277	missense	probably benign	0.04
R5995:Pex1	UTSW	5	3607704	missense	possibly damaging	0.53
R6434:Pex1	UTSW	5	3630196	nonsense	probably null
R6552:Pex1	UTSW	5	3623953	missense	probably damaging	1.00
R6777:Pex1	UTSW	5	3622358	missense	probably benign	0.01
R6877:Pex1	UTSW	5	3635505	missense	probably benign	0.19
R6948:Pex1	UTSW	5	3605994	missense	probably benign	0.00
R7317:Pex1	UTSW	5	3618875	missense	probably damaging	1.00
R7408:Pex1	UTSW	5	3630222	missense	probably damaging	1.00
R7658:Pex1	UTSW	5	3596244	unclassified	probably benign
R8062:Pex1	UTSW	5	3605656	missense	probably benign
R8354:Pex1	UTSW	5	3631707	missense	probably damaging	1.00
R8366:Pex1	UTSW	5	3626007	missense	probably benign	0.00
R8482:Pex1	UTSW	5	3612923	missense	probably benign	0.00
R8673:Pex1	UTSW	5	3635886	missense	possibly damaging	0.65
R8812:Pex1	UTSW	5	3631614	missense	probably benign	0.00
R9004:Pex1	UTSW	5	3612914	missense	probably benign	0.01
R9031:Pex1	UTSW	5	3636844	missense	probably damaging	1.00
R9080:Pex1	UTSW	5	3605476	missense	probably damaging	1.00
R9586:Pex1	UTSW	5	3626047	missense	probably damaging	0.98
R9655:Pex1	UTSW	5	3605653	missense	probably damaging	1.00
R9758:Pex1	UTSW	5	3635876	missense	probably damaging	0.96
X0019:Pex1	UTSW	5	3605653	missense	probably damaging	1.00
X0027:Pex1	UTSW	5	3630270	missense	probably damaging	0.98
Z1088:Pex1	UTSW	5	3606075	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- CTGTACACTGTGTTCATGCAAG -3'
(R):5'- GTCCCATGGCATGCTTGTTG -3'

Sequencing Primer
(F):5'- GGGTGGCTAGGttgttt -3'
(R):5'- GAGGGACACATGTTACCTGATTCC -3'

Posted On

2015-04-17