Incidental Mutation 'R3946:Pex1'
ID307699
Institutional Source Beutler Lab
Gene Symbol Pex1
Ensembl Gene ENSMUSG00000005907
Gene Nameperoxisomal biogenesis factor 1
Synonymsperoxisome biogenesis factor 1, ZWS1
MMRRC Submission 040827-MU
Accession Numbers

Genbank: NM_027777

Is this an essential gene? Possibly non essential (E-score: 0.465) question?
Stock #R3946 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location3596066-3637232 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 3626084 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 891 (L891F)
Ref Sequence ENSEMBL: ENSMUSP00000113304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006061] [ENSMUST00000121291] [ENSMUST00000143132] [ENSMUST00000195894]
Predicted Effect probably damaging
Transcript: ENSMUST00000006061
AA Change: L851F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006061
Gene: ENSMUSG00000005907
AA Change: L851F

DomainStartEndE-ValueType
Pfam:PEX-2N 14 99 2.4e-53 PFAM
Pfam:PEX-1N 103 179 8.6e-27 PFAM
low complexity region 508 527 N/A INTRINSIC
AAA 552 702 1.39e-10 SMART
low complexity region 754 765 N/A INTRINSIC
AAA 834 970 4.07e-17 SMART
low complexity region 1024 1044 N/A INTRINSIC
low complexity region 1051 1061 N/A INTRINSIC
low complexity region 1065 1078 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121291
AA Change: L891F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113304
Gene: ENSMUSG00000005907
AA Change: L891F

DomainStartEndE-ValueType
Pfam:PEX-2N 17 98 8.7e-38 PFAM
Pfam:PEX-1N 104 179 1.4e-27 PFAM
low complexity region 548 567 N/A INTRINSIC
AAA 592 742 1.39e-10 SMART
low complexity region 794 805 N/A INTRINSIC
AAA 874 1010 4.07e-17 SMART
low complexity region 1064 1084 N/A INTRINSIC
low complexity region 1091 1101 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143132
SMART Domains Protein: ENSMUSP00000116645
Gene: ENSMUSG00000005907

DomainStartEndE-ValueType
Blast:AAA 1 68 7e-31 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000195894
SMART Domains Protein: ENSMUSP00000142620
Gene: ENSMUSG00000005907

DomainStartEndE-ValueType
Pfam:PEX-2N 14 99 2.5e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199650
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA ATPase family, a large group of ATPases associated with diverse cellular activities. This protein is cytoplasmic but is often anchored to a peroxisomal membrane where it forms a heteromeric complex and plays a role in the import of proteins into peroxisomes and peroxisome biogenesis. Mutations in this gene have been associated with complementation group 1 peroxisomal disorders such as neonatal adrenoleukodystrophy, infantile Refsum disease, and Zellweger syndrome. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-in allele display premature death, postnatal growth retardation, fatty livers, a bile acid defect associated with intestinal lipid malabsorption and cholestasis, and a retinopathy associated with retinal cone cell degenerationand abnormal cone and rod electrophysiology. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 T C 13: 64,309,098 I104V probably damaging Het
Abi2 A G 1: 60,453,754 Q328R probably damaging Het
Agr3 C A 12: 35,947,513 probably benign Het
Brca2 T A 5: 150,536,704 S481R probably damaging Het
Cabin1 T G 10: 75,745,259 Q411P probably damaging Het
Calr3 A G 8: 72,443,620 Y22H probably damaging Het
Caprin1 T A 2: 103,796,766 I59F probably damaging Het
Cdk5rap1 T C 2: 154,348,716 T442A probably damaging Het
Chn2 T C 6: 54,269,426 probably benign Het
Cic C A 7: 25,272,346 R501S possibly damaging Het
Coch A G 12: 51,601,812 probably null Het
Defa25 G A 8: 21,084,490 V17I probably null Het
Dglucy T C 12: 100,838,700 probably null Het
Dtx1 T G 5: 120,681,286 T616P possibly damaging Het
Eef1g T C 19: 8,969,977 L171P probably benign Het
Fam135a A G 1: 24,030,394 S465P probably damaging Het
Gm14025 A G 2: 129,039,601 L135P probably damaging Het
Gm14412 A T 2: 177,314,685 C472* probably null Het
Gm7104 T C 12: 88,286,042 noncoding transcript Het
Got2 A G 8: 95,888,230 S26P probably benign Het
H2-M11 A G 17: 36,549,231 I329M probably damaging Het
Hmcn2 T A 2: 31,382,394 D1295E possibly damaging Het
Hoxd12 G T 2: 74,675,427 R114L probably damaging Het
Ilkap A C 1: 91,387,250 D124E probably damaging Het
Med6 T C 12: 81,581,851 Y88C probably damaging Het
Mep1a A T 17: 43,475,041 L719* probably null Het
Mmp23 T C 4: 155,652,023 Y187C probably damaging Het
Myo1g A G 11: 6,520,760 M32T possibly damaging Het
Ncstn T C 1: 172,067,494 E614G probably benign Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr1309 G A 2: 111,983,297 T259M possibly damaging Het
Otub2 T A 12: 103,392,826 L58* probably null Het
Pcdhga12 G A 18: 37,767,629 V505I probably benign Het
Pcdhga9 T A 18: 37,737,844 V242D probably damaging Het
Pgm1 C T 5: 64,112,061 T497I probably benign Het
Pikfyve T C 1: 65,196,681 F171L probably damaging Het
Pilrb1 T G 5: 137,857,392 K79T probably benign Het
Pin1 C T 9: 20,655,364 R21W probably damaging Het
Ptprq A G 10: 107,686,392 probably benign Het
Rad17 G A 13: 100,622,863 A552V possibly damaging Het
Rbbp8 A G 18: 11,718,868 T249A probably benign Het
Rtkn A T 6: 83,135,976 I10F probably benign Het
Scube2 T A 7: 109,857,590 I103F possibly damaging Het
Sec23b A G 2: 144,581,973 H514R probably benign Het
Serbp1 T A 6: 67,272,220 D223E probably benign Het
Slc14a1 C A 18: 78,111,392 V260L probably benign Het
Slc22a23 A G 13: 34,183,126 I633T probably damaging Het
Stk19 A T 17: 34,824,747 probably benign Het
Svs2 T C 2: 164,237,127 M287V probably benign Het
Syne3 T A 12: 104,958,066 Q358L probably damaging Het
Synj1 A G 16: 91,010,096 F58L possibly damaging Het
Tg T C 15: 66,674,023 V198A probably damaging Het
Tle4 A T 19: 14,597,388 Y9N probably damaging Het
Tmem57 A G 4: 134,804,481 Y626H probably damaging Het
Tmx3 G A 18: 90,524,335 A186T possibly damaging Het
Traf3 G A 12: 111,255,245 S280N possibly damaging Het
Trmt13 A G 3: 116,581,518 F447S probably damaging Het
Trp53bp1 T A 2: 121,228,626 H918L probably damaging Het
Ush2a T G 1: 188,728,504 V2654G probably benign Het
Vmn2r25 A G 6: 123,840,098 Y175H probably damaging Het
Zfp335 T C 2: 164,892,189 D1330G probably damaging Het
Other mutations in Pex1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Pex1 APN 5 3606027 missense probably benign 0.00
IGL01315:Pex1 APN 5 3609975 missense probably damaging 1.00
IGL01671:Pex1 APN 5 3624088 missense probably benign 0.00
IGL01863:Pex1 APN 5 3606066 missense probably benign 0.01
IGL01933:Pex1 APN 5 3633789 missense probably damaging 1.00
IGL01960:Pex1 APN 5 3627588 unclassified probably benign
IGL02347:Pex1 APN 5 3603350 missense probably damaging 0.98
IGL02374:Pex1 APN 5 3635481 missense probably benign 0.01
IGL02392:Pex1 APN 5 3605952 nonsense probably null
IGL02597:Pex1 APN 5 3635865 missense possibly damaging 0.50
IGL02703:Pex1 APN 5 3615120 missense probably benign 0.24
IGL02815:Pex1 APN 5 3636797 missense probably damaging 0.97
IGL02862:Pex1 APN 5 3605424 intron probably benign
IGL03005:Pex1 APN 5 3630292 missense probably null 0.96
E0370:Pex1 UTSW 5 3631614 unclassified probably null
F5493:Pex1 UTSW 5 3635912 critical splice donor site probably null
R0014:Pex1 UTSW 5 3626141 unclassified probably benign
R0014:Pex1 UTSW 5 3626141 unclassified probably benign
R0401:Pex1 UTSW 5 3633759 missense probably damaging 1.00
R0480:Pex1 UTSW 5 3606444 intron probably null
R0555:Pex1 UTSW 5 3606130 missense possibly damaging 0.89
R0976:Pex1 UTSW 5 3633943 missense probably benign 0.00
R1200:Pex1 UTSW 5 3606411 critical splice donor site probably null
R1672:Pex1 UTSW 5 3626085 missense probably damaging 1.00
R1753:Pex1 UTSW 5 3630044 missense probably damaging 1.00
R1880:Pex1 UTSW 5 3605770 missense probably benign
R1953:Pex1 UTSW 5 3630038 missense probably damaging 1.00
R2054:Pex1 UTSW 5 3603341 missense possibly damaging 0.78
R2081:Pex1 UTSW 5 3624132 critical splice donor site probably null
R2237:Pex1 UTSW 5 3618915 critical splice donor site probably null
R4528:Pex1 UTSW 5 3631712 missense probably damaging 1.00
R4579:Pex1 UTSW 5 3618880 missense probably benign 0.03
R4585:Pex1 UTSW 5 3633885 missense probably damaging 1.00
R4586:Pex1 UTSW 5 3633885 missense probably damaging 1.00
R4656:Pex1 UTSW 5 3604880 critical splice donor site probably null
R4789:Pex1 UTSW 5 3630270 missense probably damaging 0.98
R4850:Pex1 UTSW 5 3624426 missense probably benign
R4963:Pex1 UTSW 5 3609924 missense probably benign 0.01
R5005:Pex1 UTSW 5 3622310 missense probably damaging 1.00
R5015:Pex1 UTSW 5 3620597 missense probably damaging 1.00
R5019:Pex1 UTSW 5 3622331 missense probably damaging 1.00
R5937:Pex1 UTSW 5 3624487 missense possibly damaging 0.94
R5942:Pex1 UTSW 5 3610277 missense probably benign 0.04
R5995:Pex1 UTSW 5 3607704 missense possibly damaging 0.53
R6434:Pex1 UTSW 5 3630196 nonsense probably null
R6552:Pex1 UTSW 5 3623953 missense probably damaging 1.00
R6777:Pex1 UTSW 5 3622358 missense probably benign 0.01
R6877:Pex1 UTSW 5 3635505 missense probably benign 0.19
R6948:Pex1 UTSW 5 3605994 missense probably benign 0.00
R7317:Pex1 UTSW 5 3618875 missense probably damaging 1.00
R7408:Pex1 UTSW 5 3630222 missense probably damaging 1.00
R7658:Pex1 UTSW 5 3596244 unclassified probably benign
R8062:Pex1 UTSW 5 3605656 missense probably benign
X0019:Pex1 UTSW 5 3605653 missense probably damaging 1.00
X0027:Pex1 UTSW 5 3630270 missense probably damaging 0.98
Z1088:Pex1 UTSW 5 3606075 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CTGTACACTGTGTTCATGCAAG -3'
(R):5'- GTCCCATGGCATGCTTGTTG -3'

Sequencing Primer
(F):5'- GGGTGGCTAGGttgttt -3'
(R):5'- GAGGGACACATGTTACCTGATTCC -3'
Posted On2015-04-17