Mutagenetix > Incidental Mutation

Incidental Mutation 'R3946:Brca2'

307704

Institutional Source

Beutler Lab

Gene Symbol

Brca2

Ensembl Gene

ENSMUSG00000041147

Gene Name

breast cancer 2, early onset

Synonyms

Fancd1, RAB163

MMRRC Submission

040827-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3946 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

150522630-150570329 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 150536704 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 481 (S481R)

Ref Sequence

ENSEMBL: ENSMUSP00000144676 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044620] [ENSMUST00000202003] [ENSMUST00000202313]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000044620
AA Change: S481R

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000038576
Gene: ENSMUSG00000041147
AA Change: S481R

Domain	Start	End	E-Value	Type
low complexity region	36	51	N/A	INTRINSIC
low complexity region	100	123	N/A	INTRINSIC
low complexity region	187	199	N/A	INTRINSIC
low complexity region	746	761	N/A	INTRINSIC
low complexity region	904	917	N/A	INTRINSIC
Pfam:BRCA2	982	1014	2.6e-13	PFAM
Pfam:BRCA2	1193	1225	3.9e-16	PFAM
low complexity region	1239	1252	N/A	INTRINSIC
Pfam:BRCA2	1395	1425	1.4e-13	PFAM
Pfam:BRCA2	1492	1524	1.8e-13	PFAM
Pfam:BRCA2	1624	1655	8.4e-12	PFAM
Pfam:BRCA2	1925	1957	8e-15	PFAM
Pfam:BRCA2	2005	2037	1.7e-11	PFAM
Pfam:BRCA-2_helical	2402	2588	1.3e-94	PFAM
Pfam:BRCA-2_OB1	2591	2717	5.3e-44	PFAM
Tower	2752	2793	2.37e-18	SMART
Pfam:BRCA-2_OB3	2971	3104	1.5e-49	PFAM
low complexity region	3197	3208	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201149

Predicted Effect

probably damaging
Transcript: ENSMUST00000202003
AA Change: S481R

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000144676
Gene: ENSMUSG00000041147
AA Change: S481R

Domain	Start	End	E-Value	Type
low complexity region	36	51	N/A	INTRINSIC
low complexity region	100	123	N/A	INTRINSIC
low complexity region	187	199	N/A	INTRINSIC
low complexity region	746	761	N/A	INTRINSIC
low complexity region	904	917	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000202313
AA Change: S481R

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000144150
Gene: ENSMUSG00000041147
AA Change: S481R

Domain	Start	End	E-Value	Type
low complexity region	36	51	N/A	INTRINSIC
low complexity region	100	123	N/A	INTRINSIC
low complexity region	187	199	N/A	INTRINSIC
low complexity region	746	761	N/A	INTRINSIC
low complexity region	904	917	N/A	INTRINSIC
Pfam:BRCA2	982	1014	2.6e-13	PFAM
Pfam:BRCA2	1193	1225	3.9e-16	PFAM
low complexity region	1239	1252	N/A	INTRINSIC
Pfam:BRCA2	1395	1425	1.4e-13	PFAM
Pfam:BRCA2	1492	1524	1.8e-13	PFAM
Pfam:BRCA2	1624	1655	8.4e-12	PFAM
Pfam:BRCA2	1925	1957	8e-15	PFAM
Pfam:BRCA2	2005	2037	1.7e-11	PFAM
Pfam:BRCA-2_helical	2402	2588	1.3e-94	PFAM
Pfam:BRCA-2_OB1	2591	2717	5.3e-44	PFAM
Tower	2752	2793	2.37e-18	SMART
Pfam:BRCA-2_OB3	2971	3104	1.5e-49	PFAM
low complexity region	3197	3208	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202975

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.1%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Inherited mutations in BRCA1 and this gene, BRCA2, confer increased lifetime risk of developing breast or ovarian cancer. Both BRCA1 and BRCA2 are involved in maintenance of genome stability, specifically the homologous recombination pathway for double-strand DNA repair. The BRCA2 protein contains several copies of a 70 aa motif called the BRC motif, and these motifs mediate binding to the RAD51 recombinase which functions in DNA repair. BRCA2 is considered a tumor suppressor gene, as tumors with BRCA2 mutations generally exhibit loss of heterozygosity (LOH) of the wild-type allele. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA2 protein survive, are small, infertile, show improper tissue differentiation and develop lymphomas and carcinomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaed1	T	C	13: 64,309,098	I104V	probably damaging	Het
Abi2	A	G	1: 60,453,754	Q328R	probably damaging	Het
Agr3	C	A	12: 35,947,513		probably benign	Het
Cabin1	T	G	10: 75,745,259	Q411P	probably damaging	Het
Calr3	A	G	8: 72,443,620	Y22H	probably damaging	Het
Caprin1	T	A	2: 103,796,766	I59F	probably damaging	Het
Cdk5rap1	T	C	2: 154,348,716	T442A	probably damaging	Het
Chn2	T	C	6: 54,269,426		probably benign	Het
Cic	C	A	7: 25,272,346	R501S	possibly damaging	Het
Coch	A	G	12: 51,601,812		probably null	Het
Defa25	G	A	8: 21,084,490	V17I	probably null	Het
Dglucy	T	C	12: 100,838,700		probably null	Het
Dtx1	T	G	5: 120,681,286	T616P	possibly damaging	Het
Eef1g	T	C	19: 8,969,977	L171P	probably benign	Het
Fam135a	A	G	1: 24,030,394	S465P	probably damaging	Het
Gm14025	A	G	2: 129,039,601	L135P	probably damaging	Het
Gm14412	A	T	2: 177,314,685	C472*	probably null	Het
Gm7104	T	C	12: 88,286,042		noncoding transcript	Het
Got2	A	G	8: 95,888,230	S26P	probably benign	Het
H2-M11	A	G	17: 36,549,231	I329M	probably damaging	Het
Hmcn2	T	A	2: 31,382,394	D1295E	possibly damaging	Het
Hoxd12	G	T	2: 74,675,427	R114L	probably damaging	Het
Ilkap	A	C	1: 91,387,250	D124E	probably damaging	Het
Med6	T	C	12: 81,581,851	Y88C	probably damaging	Het
Mep1a	A	T	17: 43,475,041	L719*	probably null	Het
Mmp23	T	C	4: 155,652,023	Y187C	probably damaging	Het
Myo1g	A	G	11: 6,520,760	M32T	possibly damaging	Het
Ncstn	T	C	1: 172,067,494	E614G	probably benign	Het
Nr2c2	C	T	6: 92,163,138	R464W	probably damaging	Het
Olfr1309	G	A	2: 111,983,297	T259M	possibly damaging	Het
Otub2	T	A	12: 103,392,826	L58*	probably null	Het
Pcdhga12	G	A	18: 37,767,629	V505I	probably benign	Het
Pcdhga9	T	A	18: 37,737,844	V242D	probably damaging	Het
Pex1	C	T	5: 3,626,084	L891F	probably damaging	Het
Pgm1	C	T	5: 64,112,061	T497I	probably benign	Het
Pikfyve	T	C	1: 65,196,681	F171L	probably damaging	Het
Pilrb1	T	G	5: 137,857,392	K79T	probably benign	Het
Pin1	C	T	9: 20,655,364	R21W	probably damaging	Het
Ptprq	A	G	10: 107,686,392		probably benign	Het
Rad17	G	A	13: 100,622,863	A552V	possibly damaging	Het
Rbbp8	A	G	18: 11,718,868	T249A	probably benign	Het
Rtkn	A	T	6: 83,135,976	I10F	probably benign	Het
Scube2	T	A	7: 109,857,590	I103F	possibly damaging	Het
Sec23b	A	G	2: 144,581,973	H514R	probably benign	Het
Serbp1	T	A	6: 67,272,220	D223E	probably benign	Het
Slc14a1	C	A	18: 78,111,392	V260L	probably benign	Het
Slc22a23	A	G	13: 34,183,126	I633T	probably damaging	Het
Stk19	A	T	17: 34,824,747		probably benign	Het
Svs2	T	C	2: 164,237,127	M287V	probably benign	Het
Syne3	T	A	12: 104,958,066	Q358L	probably damaging	Het
Synj1	A	G	16: 91,010,096	F58L	possibly damaging	Het
Tg	T	C	15: 66,674,023	V198A	probably damaging	Het
Tle4	A	T	19: 14,597,388	Y9N	probably damaging	Het
Tmem57	A	G	4: 134,804,481	Y626H	probably damaging	Het
Tmx3	G	A	18: 90,524,335	A186T	possibly damaging	Het
Traf3	G	A	12: 111,255,245	S280N	possibly damaging	Het
Trmt13	A	G	3: 116,581,518	F447S	probably damaging	Het
Trp53bp1	T	A	2: 121,228,626	H918L	probably damaging	Het
Ush2a	T	G	1: 188,728,504	V2654G	probably benign	Het
Vmn2r25	A	G	6: 123,840,098	Y175H	probably damaging	Het
Zfp335	T	C	2: 164,892,189	D1330G	probably damaging	Het

Other mutations in Brca2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Brca2	APN	5	150539898	missense	probably benign	0.18
IGL00392:Brca2	APN	5	150541240	missense	probably benign	0.02
IGL00557:Brca2	APN	5	150560538	missense	probably benign
IGL00798:Brca2	APN	5	150539463	missense	probably benign	0.30
IGL00933:Brca2	APN	5	150542404	missense	probably benign	0.04
IGL00964:Brca2	APN	5	150532310	missense	probably damaging	1.00
IGL01152:Brca2	APN	5	150542390	missense	probably damaging	0.99
IGL01577:Brca2	APN	5	150541620	nonsense	probably null
IGL01585:Brca2	APN	5	150539516	missense	possibly damaging	0.76
IGL01732:Brca2	APN	5	150542387	missense	probably benign	0.13
IGL01809:Brca2	APN	5	150531061	splice site	probably null
IGL01911:Brca2	APN	5	150567613	missense	probably damaging	0.96
IGL02113:Brca2	APN	5	150540979	missense	possibly damaging	0.95
IGL02313:Brca2	APN	5	150538661	missense	probably damaging	1.00
IGL02342:Brca2	APN	5	150542824	missense	possibly damaging	0.94
IGL02508:Brca2	APN	5	150543308	missense	possibly damaging	0.85
IGL02532:Brca2	APN	5	150550862	missense	probably damaging	1.00
IGL02646:Brca2	APN	5	150560790	missense	possibly damaging	0.89
IGL02738:Brca2	APN	5	150567035	missense	probably damaging	1.00
IGL02833:Brca2	APN	5	150541790	missense	possibly damaging	0.83
IGL02871:Brca2	APN	5	150542552	missense	probably benign	0.13
IGL02995:Brca2	APN	5	150529488	missense	probably damaging	1.00
IGL03105:Brca2	APN	5	150560485	missense	probably benign	0.02
BB007:Brca2	UTSW	5	150558510	missense	probably damaging	0.96
BB017:Brca2	UTSW	5	150558510	missense	probably damaging	0.96
R0219:Brca2	UTSW	5	150523175	splice site	probably benign
R0416:Brca2	UTSW	5	150569392	missense	possibly damaging	0.93
R0441:Brca2	UTSW	5	150541857	missense	probably damaging	0.96
R0548:Brca2	UTSW	5	150544935	missense	probably damaging	0.96
R0745:Brca2	UTSW	5	150544882	splice site	probably benign
R0799:Brca2	UTSW	5	150560193	missense	probably damaging	0.99
R1165:Brca2	UTSW	5	150542747	missense	probably damaging	0.98
R1247:Brca2	UTSW	5	150541274	missense	probably damaging	1.00
R1403:Brca2	UTSW	5	150542649	missense	probably benign	0.22
R1403:Brca2	UTSW	5	150542649	missense	probably benign	0.22
R1444:Brca2	UTSW	5	150542450	missense	probably benign
R1466:Brca2	UTSW	5	150552258	missense	probably damaging	0.99
R1466:Brca2	UTSW	5	150552258	missense	probably damaging	0.99
R1584:Brca2	UTSW	5	150552258	missense	probably damaging	0.99
R1599:Brca2	UTSW	5	150548713	nonsense	probably null
R1600:Brca2	UTSW	5	150560830	splice site	probably benign
R1822:Brca2	UTSW	5	150540198	missense	probably benign	0.06
R1824:Brca2	UTSW	5	150536922	missense	possibly damaging	0.94
R2037:Brca2	UTSW	5	150540669	missense	probably benign
R2131:Brca2	UTSW	5	150557129	missense	probably damaging	1.00
R2203:Brca2	UTSW	5	150539502	missense	possibly damaging	0.58
R2208:Brca2	UTSW	5	150532344	missense	probably damaging	0.96
R2293:Brca2	UTSW	5	150560534	missense	possibly damaging	0.86
R2517:Brca2	UTSW	5	150539672	missense	probably benign	0.04
R2566:Brca2	UTSW	5	150541762	missense	probably benign	0.03
R3422:Brca2	UTSW	5	150543121	missense	possibly damaging	0.91
R3917:Brca2	UTSW	5	150540827	missense	probably damaging	0.96
R4176:Brca2	UTSW	5	150539633	nonsense	probably null
R4255:Brca2	UTSW	5	150541169	missense	possibly damaging	0.92
R4450:Brca2	UTSW	5	150536053	missense	probably damaging	0.96
R4603:Brca2	UTSW	5	150536165	missense	possibly damaging	0.86
R4681:Brca2	UTSW	5	150552398	splice site	probably null
R4755:Brca2	UTSW	5	150559987	splice site	probably null
R4762:Brca2	UTSW	5	150531116	missense	probably benign	0.00
R4824:Brca2	UTSW	5	150539735	missense	probably damaging	1.00
R4887:Brca2	UTSW	5	150556937	missense	probably damaging	1.00
R5020:Brca2	UTSW	5	150560436	missense	probably damaging	1.00
R5159:Brca2	UTSW	5	150542108	missense	possibly damaging	0.93
R5216:Brca2	UTSW	5	150542980	missense	probably damaging	0.99
R5269:Brca2	UTSW	5	150539223	missense	possibly damaging	0.75
R5274:Brca2	UTSW	5	150539689	missense	probably benign	0.00
R5589:Brca2	UTSW	5	150557132	missense	possibly damaging	0.67
R5619:Brca2	UTSW	5	150557114	missense	probably damaging	0.96
R5641:Brca2	UTSW	5	150556899	missense	probably damaging	1.00
R5686:Brca2	UTSW	5	150540904	missense	probably benign	0.00
R5730:Brca2	UTSW	5	150569005	missense	possibly damaging	0.85
R5763:Brca2	UTSW	5	150548006	missense	possibly damaging	0.85
R5877:Brca2	UTSW	5	150543221	missense	possibly damaging	0.53
R5893:Brca2	UTSW	5	150569138	missense	probably benign	0.02
R5900:Brca2	UTSW	5	150541132	missense	probably benign	0.01
R5926:Brca2	UTSW	5	150534622	missense	probably benign	0.07
R5966:Brca2	UTSW	5	150543251	missense	probably damaging	0.99
R6025:Brca2	UTSW	5	150541575	frame shift	probably null
R6062:Brca2	UTSW	5	150556889	missense	probably damaging	0.96
R6141:Brca2	UTSW	5	150540637	missense	possibly damaging	0.91
R6244:Brca2	UTSW	5	150566978	missense	probably benign	0.08
R6508:Brca2	UTSW	5	150536593	missense	possibly damaging	0.91
R6519:Brca2	UTSW	5	150540979	missense	probably damaging	0.99
R6611:Brca2	UTSW	5	150536193	missense	probably damaging	0.99
R6698:Brca2	UTSW	5	150532394	missense	probably damaging	1.00
R6856:Brca2	UTSW	5	150540208	missense	possibly damaging	0.68
R6912:Brca2	UTSW	5	150541742	missense	probably damaging	0.99
R7002:Brca2	UTSW	5	150539918	missense	probably benign
R7025:Brca2	UTSW	5	150540478	missense	probably benign	0.39
R7151:Brca2	UTSW	5	150541436	missense	probably benign	0.12
R7202:Brca2	UTSW	5	150532354	missense	probably benign	0.03
R7365:Brca2	UTSW	5	150532337	missense	probably damaging	0.99
R7510:Brca2	UTSW	5	150536691	missense	possibly damaging	0.85
R7612:Brca2	UTSW	5	150540611	missense	probably benign	0.03
R7682:Brca2	UTSW	5	150543153	missense	probably benign
R7890:Brca2	UTSW	5	150539381	missense	possibly damaging	0.83
R7930:Brca2	UTSW	5	150558510	missense	probably damaging	0.96
R7940:Brca2	UTSW	5	150538733	missense	probably benign
R8054:Brca2	UTSW	5	150536504	missense	probably benign	0.02
R8056:Brca2	UTSW	5	150569306	missense	possibly damaging	0.85
R8080:Brca2	UTSW	5	150539892	missense	probably benign	0.11
R8094:Brca2	UTSW	5	150536169	missense	possibly damaging	0.85
R8306:Brca2	UTSW	5	150536663	missense	possibly damaging	0.91
R8401:Brca2	UTSW	5	150552352	missense	probably damaging	1.00
R8523:Brca2	UTSW	5	150560148	missense	possibly damaging	0.75
R8784:Brca2	UTSW	5	150548661	nonsense	probably null
R8791:Brca2	UTSW	5	150542596	missense	possibly damaging	0.92
R8832:Brca2	UTSW	5	150542146	missense	possibly damaging	0.91
R8838:Brca2	UTSW	5	150541540	missense	possibly damaging	0.91
R8845:Brca2	UTSW	5	150543382	missense	possibly damaging	0.85
R8898:Brca2	UTSW	5	150569033	missense	possibly damaging	0.53
R8914:Brca2	UTSW	5	150541743	missense	probably damaging	0.96
R8935:Brca2	UTSW	5	150568981	missense	possibly damaging	0.70
R9014:Brca2	UTSW	5	150541754	missense	probably benign
R9023:Brca2	UTSW	5	150541895	missense	probably benign	0.07
R9094:Brca2	UTSW	5	150552305	missense	probably benign	0.08
R9195:Brca2	UTSW	5	150539953	missense	possibly damaging	0.83
R9198:Brca2	UTSW	5	150536512	missense	possibly damaging	0.91
R9314:Brca2	UTSW	5	150550894	missense	probably damaging	0.96
R9408:Brca2	UTSW	5	150541517	missense	probably damaging	1.00
R9459:Brca2	UTSW	5	150540629	missense	probably damaging	0.98
R9512:Brca2	UTSW	5	150531081	missense	probably benign	0.40
R9622:Brca2	UTSW	5	150556945	missense	probably damaging	0.96
R9777:Brca2	UTSW	5	150557114	missense	probably damaging	0.99
Z1088:Brca2	UTSW	5	150542763	missense	probably damaging	0.96
Z1186:Brca2	UTSW	5	150536583	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AAGAAGGTACTGGCTCTATTACTTC -3'
(R):5'- CACAGTGGCAGAAGTGTCAG -3'

Sequencing Primer
(F):5'- ACTGGCTCTATTACTTCAGAAAAATC -3'
(R):5'- ATAGAATCCTCTCTCTGTGAGCATG -3'

Posted On

2015-04-17