Incidental Mutation 'R3946:Rtkn'
ID307706
Institutional Source Beutler Lab
Gene Symbol Rtkn
Ensembl Gene ENSMUSG00000034930
Gene Namerhotekin
Synonyms
MMRRC Submission 040827-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R3946 (G1)
Quality Score101
Status Validated
Chromosome6
Chromosomal Location83135463-83152579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83135976 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 10 (I10F)
Ref Sequence ENSEMBL: ENSMUSP00000065571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065512] [ENSMUST00000087938] [ENSMUST00000121093] [ENSMUST00000135490]
Predicted Effect probably benign
Transcript: ENSMUST00000065512
AA Change: I10F

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000065571
Gene: ENSMUSG00000034930
AA Change: I10F

DomainStartEndE-ValueType
Hr1 36 99 5.65e-13 SMART
Pfam:Anillin 117 270 8.3e-46 PFAM
PH 310 418 2.3e-4 SMART
low complexity region 490 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087938
SMART Domains Protein: ENSMUSP00000085249
Gene: ENSMUSG00000034930

DomainStartEndE-ValueType
Hr1 23 86 1.62e-13 SMART
Pfam:Anillin 103 258 8e-25 PFAM
PH 297 405 2.3e-4 SMART
low complexity region 477 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121093
SMART Domains Protein: ENSMUSP00000112501
Gene: ENSMUSG00000034930

DomainStartEndE-ValueType
Hr1 23 86 1.62e-13 SMART
Pfam:Anillin 103 258 8e-25 PFAM
PH 297 405 2.3e-4 SMART
low complexity region 477 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135490
SMART Domains Protein: ENSMUSP00000116964
Gene: ENSMUSG00000034930

DomainStartEndE-ValueType
Blast:Hr1 1 49 2e-25 BLAST
Pfam:Anillin 66 221 1.8e-25 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein that interacts with GTP-bound Rho proteins. Binding of this protein inhibits the GTPase activity of Rho proteins. This protein may interfere with the conversion of active, GTP-bound Rho to the inactive GDP-bound form by RhoGAP. Rho proteins regulate many important cellular processes, including cytokinesis, transcription, smooth muscle contraction, cell growth and transformation. Dysregulation of the Rho signal transduction pathway has been implicated in many forms of cancer. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 T C 13: 64,309,098 I104V probably damaging Het
Abi2 A G 1: 60,453,754 Q328R probably damaging Het
Agr3 C A 12: 35,947,513 probably benign Het
Brca2 T A 5: 150,536,704 S481R probably damaging Het
Cabin1 T G 10: 75,745,259 Q411P probably damaging Het
Calr3 A G 8: 72,443,620 Y22H probably damaging Het
Caprin1 T A 2: 103,796,766 I59F probably damaging Het
Cdk5rap1 T C 2: 154,348,716 T442A probably damaging Het
Chn2 T C 6: 54,269,426 probably benign Het
Cic C A 7: 25,272,346 R501S possibly damaging Het
Coch A G 12: 51,601,812 probably null Het
Defa25 G A 8: 21,084,490 V17I probably null Het
Dglucy T C 12: 100,838,700 probably null Het
Dtx1 T G 5: 120,681,286 T616P possibly damaging Het
Eef1g T C 19: 8,969,977 L171P probably benign Het
Fam135a A G 1: 24,030,394 S465P probably damaging Het
Gm14025 A G 2: 129,039,601 L135P probably damaging Het
Gm14412 A T 2: 177,314,685 C472* probably null Het
Gm7104 T C 12: 88,286,042 noncoding transcript Het
Got2 A G 8: 95,888,230 S26P probably benign Het
H2-M11 A G 17: 36,549,231 I329M probably damaging Het
Hmcn2 T A 2: 31,382,394 D1295E possibly damaging Het
Hoxd12 G T 2: 74,675,427 R114L probably damaging Het
Ilkap A C 1: 91,387,250 D124E probably damaging Het
Med6 T C 12: 81,581,851 Y88C probably damaging Het
Mep1a A T 17: 43,475,041 L719* probably null Het
Mmp23 T C 4: 155,652,023 Y187C probably damaging Het
Myo1g A G 11: 6,520,760 M32T possibly damaging Het
Ncstn T C 1: 172,067,494 E614G probably benign Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr1309 G A 2: 111,983,297 T259M possibly damaging Het
Otub2 T A 12: 103,392,826 L58* probably null Het
Pcdhga12 G A 18: 37,767,629 V505I probably benign Het
Pcdhga9 T A 18: 37,737,844 V242D probably damaging Het
Pex1 C T 5: 3,626,084 L891F probably damaging Het
Pgm1 C T 5: 64,112,061 T497I probably benign Het
Pikfyve T C 1: 65,196,681 F171L probably damaging Het
Pilrb1 T G 5: 137,857,392 K79T probably benign Het
Pin1 C T 9: 20,655,364 R21W probably damaging Het
Ptprq A G 10: 107,686,392 probably benign Het
Rad17 G A 13: 100,622,863 A552V possibly damaging Het
Rbbp8 A G 18: 11,718,868 T249A probably benign Het
Scube2 T A 7: 109,857,590 I103F possibly damaging Het
Sec23b A G 2: 144,581,973 H514R probably benign Het
Serbp1 T A 6: 67,272,220 D223E probably benign Het
Slc14a1 C A 18: 78,111,392 V260L probably benign Het
Slc22a23 A G 13: 34,183,126 I633T probably damaging Het
Stk19 A T 17: 34,824,747 probably benign Het
Svs2 T C 2: 164,237,127 M287V probably benign Het
Syne3 T A 12: 104,958,066 Q358L probably damaging Het
Synj1 A G 16: 91,010,096 F58L possibly damaging Het
Tg T C 15: 66,674,023 V198A probably damaging Het
Tle4 A T 19: 14,597,388 Y9N probably damaging Het
Tmem57 A G 4: 134,804,481 Y626H probably damaging Het
Tmx3 G A 18: 90,524,335 A186T possibly damaging Het
Traf3 G A 12: 111,255,245 S280N possibly damaging Het
Trmt13 A G 3: 116,581,518 F447S probably damaging Het
Trp53bp1 T A 2: 121,228,626 H918L probably damaging Het
Ush2a T G 1: 188,728,504 V2654G probably benign Het
Vmn2r25 A G 6: 123,840,098 Y175H probably damaging Het
Zfp335 T C 2: 164,892,189 D1330G probably damaging Het
Other mutations in Rtkn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Rtkn APN 6 83146061 missense probably damaging 1.00
IGL02265:Rtkn APN 6 83147542 missense probably damaging 1.00
IGL02551:Rtkn APN 6 83151924 missense probably damaging 1.00
IGL03028:Rtkn APN 6 83147872 nonsense probably null
IGL03388:Rtkn APN 6 83150090 missense probably benign 0.02
R1648:Rtkn UTSW 6 83135994 missense probably damaging 1.00
R2100:Rtkn UTSW 6 83149560 splice site probably null
R2517:Rtkn UTSW 6 83147545 missense probably damaging 1.00
R3608:Rtkn UTSW 6 83150035 missense probably damaging 0.97
R4170:Rtkn UTSW 6 83142395 start codon destroyed probably null
R4630:Rtkn UTSW 6 83152182 nonsense probably null
R5044:Rtkn UTSW 6 83150991 missense probably benign 0.01
R5102:Rtkn UTSW 6 83149773 missense probably damaging 0.98
R6165:Rtkn UTSW 6 83145963 missense probably damaging 1.00
R6372:Rtkn UTSW 6 83151901 missense possibly damaging 0.96
R7101:Rtkn UTSW 6 83150012 missense possibly damaging 0.76
R7155:Rtkn UTSW 6 83149711 missense probably damaging 0.99
R7251:Rtkn UTSW 6 83135962 missense probably damaging 1.00
R7381:Rtkn UTSW 6 83151745 missense probably damaging 0.97
R7598:Rtkn UTSW 6 83147903 missense probably null 0.96
R7624:Rtkn UTSW 6 83152177 missense probably benign
R8306:Rtkn UTSW 6 83151916 missense probably damaging 1.00
R8935:Rtkn UTSW 6 83138215 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCGACCCAAACTGGCTTG -3'
(R):5'- CTTGAGCTAGAATAGACCCAGATC -3'

Sequencing Primer
(F):5'- AAACTGGCTTGGCACCC -3'
(R):5'- GCGACTCGCTGAAGAAA -3'
Posted On2015-04-17