Incidental Mutation 'R3946:Rtkn'
ID 307706
Institutional Source Beutler Lab
Gene Symbol Rtkn
Ensembl Gene ENSMUSG00000034930
Gene Name rhotekin
Synonyms
MMRRC Submission 040827-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R3946 (G1)
Quality Score 101
Status Validated
Chromosome 6
Chromosomal Location 83112485-83129560 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 83112957 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 10 (I10F)
Ref Sequence ENSEMBL: ENSMUSP00000065571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065512] [ENSMUST00000087938] [ENSMUST00000121093] [ENSMUST00000135490]
AlphaFold Q8C6B2
Predicted Effect probably benign
Transcript: ENSMUST00000065512
AA Change: I10F

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000065571
Gene: ENSMUSG00000034930
AA Change: I10F

DomainStartEndE-ValueType
Hr1 36 99 5.65e-13 SMART
Pfam:Anillin 117 270 8.3e-46 PFAM
PH 310 418 2.3e-4 SMART
low complexity region 490 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087938
SMART Domains Protein: ENSMUSP00000085249
Gene: ENSMUSG00000034930

DomainStartEndE-ValueType
Hr1 23 86 1.62e-13 SMART
Pfam:Anillin 103 258 8e-25 PFAM
PH 297 405 2.3e-4 SMART
low complexity region 477 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121093
SMART Domains Protein: ENSMUSP00000112501
Gene: ENSMUSG00000034930

DomainStartEndE-ValueType
Hr1 23 86 1.62e-13 SMART
Pfam:Anillin 103 258 8e-25 PFAM
PH 297 405 2.3e-4 SMART
low complexity region 477 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135490
SMART Domains Protein: ENSMUSP00000116964
Gene: ENSMUSG00000034930

DomainStartEndE-ValueType
Blast:Hr1 1 49 2e-25 BLAST
Pfam:Anillin 66 221 1.8e-25 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein that interacts with GTP-bound Rho proteins. Binding of this protein inhibits the GTPase activity of Rho proteins. This protein may interfere with the conversion of active, GTP-bound Rho to the inactive GDP-bound form by RhoGAP. Rho proteins regulate many important cellular processes, including cytokinesis, transcription, smooth muscle contraction, cell growth and transformation. Dysregulation of the Rho signal transduction pathway has been implicated in many forms of cancer. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi2 A G 1: 60,492,913 (GRCm39) Q328R probably damaging Het
Agr3 C A 12: 35,997,512 (GRCm39) probably benign Het
Brca2 T A 5: 150,460,169 (GRCm39) S481R probably damaging Het
Cabin1 T G 10: 75,581,093 (GRCm39) Q411P probably damaging Het
Calr3 A G 8: 73,197,464 (GRCm39) Y22H probably damaging Het
Caprin1 T A 2: 103,627,111 (GRCm39) I59F probably damaging Het
Cdk5rap1 T C 2: 154,190,636 (GRCm39) T442A probably damaging Het
Chn2 T C 6: 54,246,411 (GRCm39) probably benign Het
Cic C A 7: 24,971,771 (GRCm39) R501S possibly damaging Het
Coch A G 12: 51,648,595 (GRCm39) probably null Het
Defa25 G A 8: 21,574,506 (GRCm39) V17I probably null Het
Dglucy T C 12: 100,804,959 (GRCm39) probably null Het
Dtx1 T G 5: 120,819,351 (GRCm39) T616P possibly damaging Het
Eef1g T C 19: 8,947,341 (GRCm39) L171P probably benign Het
Fam135a A G 1: 24,069,475 (GRCm39) S465P probably damaging Het
Gm14412 A T 2: 177,006,478 (GRCm39) C472* probably null Het
Gm7104 T C 12: 88,252,812 (GRCm39) noncoding transcript Het
Got2 A G 8: 96,614,858 (GRCm39) S26P probably benign Het
H2-M11 A G 17: 36,860,123 (GRCm39) I329M probably damaging Het
Hmcn2 T A 2: 31,272,406 (GRCm39) D1295E possibly damaging Het
Hoxd12 G T 2: 74,505,771 (GRCm39) R114L probably damaging Het
Ilkap A C 1: 91,314,972 (GRCm39) D124E probably damaging Het
Maco1 A G 4: 134,531,792 (GRCm39) Y626H probably damaging Het
Med6 T C 12: 81,628,625 (GRCm39) Y88C probably damaging Het
Mep1a A T 17: 43,785,932 (GRCm39) L719* probably null Het
Mmp23 T C 4: 155,736,480 (GRCm39) Y187C probably damaging Het
Myo1g A G 11: 6,470,760 (GRCm39) M32T possibly damaging Het
Ncstn T C 1: 171,895,061 (GRCm39) E614G probably benign Het
Nr2c2 C T 6: 92,140,119 (GRCm39) R464W probably damaging Het
Or4f15 G A 2: 111,813,642 (GRCm39) T259M possibly damaging Het
Otub2 T A 12: 103,359,085 (GRCm39) L58* probably null Het
Pcdhga12 G A 18: 37,900,682 (GRCm39) V505I probably benign Het
Pcdhga9 T A 18: 37,870,897 (GRCm39) V242D probably damaging Het
Pex1 C T 5: 3,676,084 (GRCm39) L891F probably damaging Het
Pgm2 C T 5: 64,269,404 (GRCm39) T497I probably benign Het
Pikfyve T C 1: 65,235,840 (GRCm39) F171L probably damaging Het
Pilrb1 T G 5: 137,855,654 (GRCm39) K79T probably benign Het
Pin1 C T 9: 20,566,660 (GRCm39) R21W probably damaging Het
Prxl2c T C 13: 64,456,912 (GRCm39) I104V probably damaging Het
Ptprq A G 10: 107,522,253 (GRCm39) probably benign Het
Rad17 G A 13: 100,759,371 (GRCm39) A552V possibly damaging Het
Rbbp8 A G 18: 11,851,925 (GRCm39) T249A probably benign Het
Scube2 T A 7: 109,456,797 (GRCm39) I103F possibly damaging Het
Sec23b A G 2: 144,423,893 (GRCm39) H514R probably benign Het
Serbp1 T A 6: 67,249,204 (GRCm39) D223E probably benign Het
Slc14a1 C A 18: 78,154,607 (GRCm39) V260L probably benign Het
Slc22a23 A G 13: 34,367,109 (GRCm39) I633T probably damaging Het
Stk19 A T 17: 35,043,723 (GRCm39) probably benign Het
Svs5 T C 2: 164,079,047 (GRCm39) M287V probably benign Het
Syne3 T A 12: 104,924,325 (GRCm39) Q358L probably damaging Het
Synj1 A G 16: 90,806,984 (GRCm39) F58L possibly damaging Het
Tg T C 15: 66,545,872 (GRCm39) V198A probably damaging Het
Tle4 A T 19: 14,574,752 (GRCm39) Y9N probably damaging Het
Tmx3 G A 18: 90,542,459 (GRCm39) A186T possibly damaging Het
Traf3 G A 12: 111,221,679 (GRCm39) S280N possibly damaging Het
Trmt13 A G 3: 116,375,167 (GRCm39) F447S probably damaging Het
Trp53bp1 T A 2: 121,059,107 (GRCm39) H918L probably damaging Het
Ush2a T G 1: 188,460,701 (GRCm39) V2654G probably benign Het
Vinac1 A G 2: 128,881,521 (GRCm39) L135P probably damaging Het
Vmn2r25 A G 6: 123,817,057 (GRCm39) Y175H probably damaging Het
Zfp335 T C 2: 164,734,109 (GRCm39) D1330G probably damaging Het
Other mutations in Rtkn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Rtkn APN 6 83,123,042 (GRCm39) missense probably damaging 1.00
IGL02265:Rtkn APN 6 83,124,523 (GRCm39) missense probably damaging 1.00
IGL02551:Rtkn APN 6 83,128,905 (GRCm39) missense probably damaging 1.00
IGL03028:Rtkn APN 6 83,124,853 (GRCm39) nonsense probably null
IGL03388:Rtkn APN 6 83,127,071 (GRCm39) missense probably benign 0.02
R1648:Rtkn UTSW 6 83,112,975 (GRCm39) missense probably damaging 1.00
R2100:Rtkn UTSW 6 83,126,541 (GRCm39) splice site probably null
R2517:Rtkn UTSW 6 83,124,526 (GRCm39) missense probably damaging 1.00
R3608:Rtkn UTSW 6 83,127,016 (GRCm39) missense probably damaging 0.97
R4170:Rtkn UTSW 6 83,119,376 (GRCm39) start codon destroyed probably null
R4630:Rtkn UTSW 6 83,129,163 (GRCm39) nonsense probably null
R5044:Rtkn UTSW 6 83,127,972 (GRCm39) missense probably benign 0.01
R5102:Rtkn UTSW 6 83,126,754 (GRCm39) missense probably damaging 0.98
R6165:Rtkn UTSW 6 83,122,944 (GRCm39) missense probably damaging 1.00
R6372:Rtkn UTSW 6 83,128,882 (GRCm39) missense possibly damaging 0.96
R7101:Rtkn UTSW 6 83,126,993 (GRCm39) missense possibly damaging 0.76
R7155:Rtkn UTSW 6 83,126,692 (GRCm39) missense probably damaging 0.99
R7251:Rtkn UTSW 6 83,112,943 (GRCm39) missense probably damaging 1.00
R7381:Rtkn UTSW 6 83,128,726 (GRCm39) missense probably damaging 0.97
R7598:Rtkn UTSW 6 83,124,884 (GRCm39) missense probably null 0.96
R7624:Rtkn UTSW 6 83,129,158 (GRCm39) missense probably benign
R8306:Rtkn UTSW 6 83,128,897 (GRCm39) missense probably damaging 1.00
R8935:Rtkn UTSW 6 83,115,196 (GRCm39) missense probably damaging 1.00
R9094:Rtkn UTSW 6 83,128,018 (GRCm39) missense possibly damaging 0.92
R9169:Rtkn UTSW 6 83,129,190 (GRCm39) missense probably damaging 1.00
R9252:Rtkn UTSW 6 83,125,143 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCGACCCAAACTGGCTTG -3'
(R):5'- CTTGAGCTAGAATAGACCCAGATC -3'

Sequencing Primer
(F):5'- AAACTGGCTTGGCACCC -3'
(R):5'- GCGACTCGCTGAAGAAA -3'
Posted On 2015-04-17