Incidental Mutation 'R3946:Nr2c2'
ID 307707
Institutional Source Beutler Lab
Gene Symbol Nr2c2
Ensembl Gene ENSMUSG00000005893
Gene Name nuclear receptor subfamily 2, group C, member 2
Synonyms Tr4, TAK1
MMRRC Submission 040827-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.586) question?
Stock # R3946 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 92068426-92150039 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 92140119 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 464 (R464W)
Ref Sequence ENSEMBL: ENSMUSP00000138465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113460] [ENSMUST00000113463] [ENSMUST00000146175]
AlphaFold P49117
Predicted Effect probably damaging
Transcript: ENSMUST00000113460
AA Change: R464W

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109087
Gene: ENSMUSG00000005893
AA Change: R464W

DomainStartEndE-ValueType
ZnF_C4 114 185 4.33e-40 SMART
Blast:HOLI 238 324 4e-46 BLAST
HOLI 388 554 1.9e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113463
AA Change: R497W

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109090
Gene: ENSMUSG00000005893
AA Change: R497W

DomainStartEndE-ValueType
ZnF_C4 147 218 4.33e-40 SMART
Blast:HOLI 271 357 6e-46 BLAST
HOLI 421 587 1.9e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000146175
AA Change: R464W

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138465
Gene: ENSMUSG00000005893
AA Change: R464W

DomainStartEndE-ValueType
ZnF_C4 114 185 4.33e-40 SMART
Blast:HOLI 238 324 7e-47 BLAST
Pfam:Hormone_recep 367 493 8.8e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204497
Meta Mutation Damage Score 0.2279 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the nuclear hormone receptor family. Members of this family act as ligand-activated transcription factors and function in many biological processes such as development, cellular differentiation and homeostasis. The activated receptor/ligand complex is translocated to the nucleus where it binds to hormone response elements of target genes. The protein encoded by this gene plays a role in protecting cells from oxidative stress and damage induced by ionizing radiation. The lack of a similar gene in mouse results in growth retardation, severe spinal curvature, subfertility, premature aging, and prostatic intraepithelial neoplasia (PIN) development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous null mice display reduced body size, reduced male fertility, and impaired spermatogenesis. Mice homozygous for a conditional allele activated in the CNS exhibit increased thermal, mechanical and chemical nociception threshold, decreased pruritus and neuronal loss in the spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi2 A G 1: 60,492,913 (GRCm39) Q328R probably damaging Het
Agr3 C A 12: 35,997,512 (GRCm39) probably benign Het
Brca2 T A 5: 150,460,169 (GRCm39) S481R probably damaging Het
Cabin1 T G 10: 75,581,093 (GRCm39) Q411P probably damaging Het
Calr3 A G 8: 73,197,464 (GRCm39) Y22H probably damaging Het
Caprin1 T A 2: 103,627,111 (GRCm39) I59F probably damaging Het
Cdk5rap1 T C 2: 154,190,636 (GRCm39) T442A probably damaging Het
Chn2 T C 6: 54,246,411 (GRCm39) probably benign Het
Cic C A 7: 24,971,771 (GRCm39) R501S possibly damaging Het
Coch A G 12: 51,648,595 (GRCm39) probably null Het
Defa25 G A 8: 21,574,506 (GRCm39) V17I probably null Het
Dglucy T C 12: 100,804,959 (GRCm39) probably null Het
Dtx1 T G 5: 120,819,351 (GRCm39) T616P possibly damaging Het
Eef1g T C 19: 8,947,341 (GRCm39) L171P probably benign Het
Fam135a A G 1: 24,069,475 (GRCm39) S465P probably damaging Het
Gm14412 A T 2: 177,006,478 (GRCm39) C472* probably null Het
Gm7104 T C 12: 88,252,812 (GRCm39) noncoding transcript Het
Got2 A G 8: 96,614,858 (GRCm39) S26P probably benign Het
H2-M11 A G 17: 36,860,123 (GRCm39) I329M probably damaging Het
Hmcn2 T A 2: 31,272,406 (GRCm39) D1295E possibly damaging Het
Hoxd12 G T 2: 74,505,771 (GRCm39) R114L probably damaging Het
Ilkap A C 1: 91,314,972 (GRCm39) D124E probably damaging Het
Maco1 A G 4: 134,531,792 (GRCm39) Y626H probably damaging Het
Med6 T C 12: 81,628,625 (GRCm39) Y88C probably damaging Het
Mep1a A T 17: 43,785,932 (GRCm39) L719* probably null Het
Mmp23 T C 4: 155,736,480 (GRCm39) Y187C probably damaging Het
Myo1g A G 11: 6,470,760 (GRCm39) M32T possibly damaging Het
Ncstn T C 1: 171,895,061 (GRCm39) E614G probably benign Het
Or4f15 G A 2: 111,813,642 (GRCm39) T259M possibly damaging Het
Otub2 T A 12: 103,359,085 (GRCm39) L58* probably null Het
Pcdhga12 G A 18: 37,900,682 (GRCm39) V505I probably benign Het
Pcdhga9 T A 18: 37,870,897 (GRCm39) V242D probably damaging Het
Pex1 C T 5: 3,676,084 (GRCm39) L891F probably damaging Het
Pgm2 C T 5: 64,269,404 (GRCm39) T497I probably benign Het
Pikfyve T C 1: 65,235,840 (GRCm39) F171L probably damaging Het
Pilrb1 T G 5: 137,855,654 (GRCm39) K79T probably benign Het
Pin1 C T 9: 20,566,660 (GRCm39) R21W probably damaging Het
Prxl2c T C 13: 64,456,912 (GRCm39) I104V probably damaging Het
Ptprq A G 10: 107,522,253 (GRCm39) probably benign Het
Rad17 G A 13: 100,759,371 (GRCm39) A552V possibly damaging Het
Rbbp8 A G 18: 11,851,925 (GRCm39) T249A probably benign Het
Rtkn A T 6: 83,112,957 (GRCm39) I10F probably benign Het
Scube2 T A 7: 109,456,797 (GRCm39) I103F possibly damaging Het
Sec23b A G 2: 144,423,893 (GRCm39) H514R probably benign Het
Serbp1 T A 6: 67,249,204 (GRCm39) D223E probably benign Het
Slc14a1 C A 18: 78,154,607 (GRCm39) V260L probably benign Het
Slc22a23 A G 13: 34,367,109 (GRCm39) I633T probably damaging Het
Stk19 A T 17: 35,043,723 (GRCm39) probably benign Het
Svs5 T C 2: 164,079,047 (GRCm39) M287V probably benign Het
Syne3 T A 12: 104,924,325 (GRCm39) Q358L probably damaging Het
Synj1 A G 16: 90,806,984 (GRCm39) F58L possibly damaging Het
Tg T C 15: 66,545,872 (GRCm39) V198A probably damaging Het
Tle4 A T 19: 14,574,752 (GRCm39) Y9N probably damaging Het
Tmx3 G A 18: 90,542,459 (GRCm39) A186T possibly damaging Het
Traf3 G A 12: 111,221,679 (GRCm39) S280N possibly damaging Het
Trmt13 A G 3: 116,375,167 (GRCm39) F447S probably damaging Het
Trp53bp1 T A 2: 121,059,107 (GRCm39) H918L probably damaging Het
Ush2a T G 1: 188,460,701 (GRCm39) V2654G probably benign Het
Vinac1 A G 2: 128,881,521 (GRCm39) L135P probably damaging Het
Vmn2r25 A G 6: 123,817,057 (GRCm39) Y175H probably damaging Het
Zfp335 T C 2: 164,734,109 (GRCm39) D1330G probably damaging Het
Other mutations in Nr2c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Nr2c2 APN 6 92,126,700 (GRCm39) missense probably damaging 1.00
IGL01129:Nr2c2 APN 6 92,135,397 (GRCm39) missense probably benign 0.08
IGL01578:Nr2c2 APN 6 92,139,019 (GRCm39) missense probably benign 0.01
IGL02281:Nr2c2 APN 6 92,131,495 (GRCm39) missense probably benign 0.20
R1385:Nr2c2 UTSW 6 92,131,451 (GRCm39) missense probably damaging 1.00
R1397:Nr2c2 UTSW 6 92,126,745 (GRCm39) missense probably benign 0.34
R1503:Nr2c2 UTSW 6 92,082,312 (GRCm39) missense probably benign
R1691:Nr2c2 UTSW 6 92,133,673 (GRCm39) missense probably damaging 0.99
R1779:Nr2c2 UTSW 6 92,136,224 (GRCm39) missense possibly damaging 0.50
R2655:Nr2c2 UTSW 6 92,140,119 (GRCm39) missense probably damaging 0.99
R3840:Nr2c2 UTSW 6 92,140,119 (GRCm39) missense probably damaging 0.99
R3841:Nr2c2 UTSW 6 92,140,119 (GRCm39) missense probably damaging 0.99
R3923:Nr2c2 UTSW 6 92,137,382 (GRCm39) missense probably damaging 0.98
R3926:Nr2c2 UTSW 6 92,137,382 (GRCm39) missense probably damaging 0.98
R3945:Nr2c2 UTSW 6 92,140,119 (GRCm39) missense probably damaging 0.99
R4721:Nr2c2 UTSW 6 92,116,828 (GRCm39) missense possibly damaging 0.49
R5038:Nr2c2 UTSW 6 92,116,803 (GRCm39) missense probably damaging 1.00
R5101:Nr2c2 UTSW 6 92,131,497 (GRCm39) critical splice donor site probably null
R5524:Nr2c2 UTSW 6 92,116,746 (GRCm39) splice site probably null
R6884:Nr2c2 UTSW 6 92,135,374 (GRCm39) missense probably benign 0.05
R7046:Nr2c2 UTSW 6 92,135,338 (GRCm39) missense probably damaging 1.00
R7278:Nr2c2 UTSW 6 92,136,359 (GRCm39) missense probably damaging 0.96
R7316:Nr2c2 UTSW 6 92,131,444 (GRCm39) missense probably damaging 0.99
R9238:Nr2c2 UTSW 6 92,144,530 (GRCm39) missense probably damaging 1.00
R9497:Nr2c2 UTSW 6 92,133,673 (GRCm39) missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TCTGGAAATGCAGCCCTTG -3'
(R):5'- TCCCCAGGAACATTTCTTTAGGG -3'

Sequencing Primer
(F):5'- GCCCTTGACAAGCTTGAAATG -3'
(R):5'- AGGGCTTTCCTACACAACTGATG -3'
Posted On 2015-04-17