Mutagenetix > Incidental Mutation

Incidental Mutation 'R3946:Nr2c2'

307707

Institutional Source

Beutler Lab

Gene Symbol

Nr2c2

Ensembl Gene

ENSMUSG00000005893

Gene Name

nuclear receptor subfamily 2, group C, member 2

Synonyms

TAK1, Tr4

MMRRC Submission

040827-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.514) question?

Stock #

R3946 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92091390-92174294 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 92163138 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 464 (R464W)

Ref Sequence

ENSEMBL: ENSMUSP00000138465 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113460] [ENSMUST00000113463] [ENSMUST00000146175]

AlphaFold

P49117

Predicted Effect

probably damaging
Transcript: ENSMUST00000113460
AA Change: R464W

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000109087
Gene: ENSMUSG00000005893
AA Change: R464W

Domain	Start	End	E-Value	Type
ZnF_C4	114	185	4.33e-40	SMART
Blast:HOLI	238	324	4e-46	BLAST
HOLI	388	554	1.9e-36	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000113463
AA Change: R497W

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000109090
Gene: ENSMUSG00000005893
AA Change: R497W

Domain	Start	End	E-Value	Type
ZnF_C4	147	218	4.33e-40	SMART
Blast:HOLI	271	357	6e-46	BLAST
HOLI	421	587	1.9e-36	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000146175
AA Change: R464W

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000138465
Gene: ENSMUSG00000005893
AA Change: R464W

Domain	Start	End	E-Value	Type
ZnF_C4	114	185	4.33e-40	SMART
Blast:HOLI	238	324	7e-47	BLAST
Pfam:Hormone_recep	367	493	8.8e-15	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204349

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204497

Meta Mutation Damage Score

0.2279

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.1%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the nuclear hormone receptor family. Members of this family act as ligand-activated transcription factors and function in many biological processes such as development, cellular differentiation and homeostasis. The activated receptor/ligand complex is translocated to the nucleus where it binds to hormone response elements of target genes. The protein encoded by this gene plays a role in protecting cells from oxidative stress and damage induced by ionizing radiation. The lack of a similar gene in mouse results in growth retardation, severe spinal curvature, subfertility, premature aging, and prostatic intraepithelial neoplasia (PIN) development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous null mice display reduced body size, reduced male fertility, and impaired spermatogenesis. Mice homozygous for a conditional allele activated in the CNS exhibit increased thermal, mechanical and chemical nociception threshold, decreased pruritus and neuronal loss in the spinal cord. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaed1	T	C	13: 64,309,098	I104V	probably damaging	Het
Abi2	A	G	1: 60,453,754	Q328R	probably damaging	Het
Agr3	C	A	12: 35,947,513		probably benign	Het
Brca2	T	A	5: 150,536,704	S481R	probably damaging	Het
Cabin1	T	G	10: 75,745,259	Q411P	probably damaging	Het
Calr3	A	G	8: 72,443,620	Y22H	probably damaging	Het
Caprin1	T	A	2: 103,796,766	I59F	probably damaging	Het
Cdk5rap1	T	C	2: 154,348,716	T442A	probably damaging	Het
Chn2	T	C	6: 54,269,426		probably benign	Het
Cic	C	A	7: 25,272,346	R501S	possibly damaging	Het
Coch	A	G	12: 51,601,812		probably null	Het
Defa25	G	A	8: 21,084,490	V17I	probably null	Het
Dglucy	T	C	12: 100,838,700		probably null	Het
Dtx1	T	G	5: 120,681,286	T616P	possibly damaging	Het
Eef1g	T	C	19: 8,969,977	L171P	probably benign	Het
Fam135a	A	G	1: 24,030,394	S465P	probably damaging	Het
Gm14025	A	G	2: 129,039,601	L135P	probably damaging	Het
Gm14412	A	T	2: 177,314,685	C472*	probably null	Het
Gm7104	T	C	12: 88,286,042		noncoding transcript	Het
Got2	A	G	8: 95,888,230	S26P	probably benign	Het
H2-M11	A	G	17: 36,549,231	I329M	probably damaging	Het
Hmcn2	T	A	2: 31,382,394	D1295E	possibly damaging	Het
Hoxd12	G	T	2: 74,675,427	R114L	probably damaging	Het
Ilkap	A	C	1: 91,387,250	D124E	probably damaging	Het
Med6	T	C	12: 81,581,851	Y88C	probably damaging	Het
Mep1a	A	T	17: 43,475,041	L719*	probably null	Het
Mmp23	T	C	4: 155,652,023	Y187C	probably damaging	Het
Myo1g	A	G	11: 6,520,760	M32T	possibly damaging	Het
Ncstn	T	C	1: 172,067,494	E614G	probably benign	Het
Olfr1309	G	A	2: 111,983,297	T259M	possibly damaging	Het
Otub2	T	A	12: 103,392,826	L58*	probably null	Het
Pcdhga12	G	A	18: 37,767,629	V505I	probably benign	Het
Pcdhga9	T	A	18: 37,737,844	V242D	probably damaging	Het
Pex1	C	T	5: 3,626,084	L891F	probably damaging	Het
Pgm1	C	T	5: 64,112,061	T497I	probably benign	Het
Pikfyve	T	C	1: 65,196,681	F171L	probably damaging	Het
Pilrb1	T	G	5: 137,857,392	K79T	probably benign	Het
Pin1	C	T	9: 20,655,364	R21W	probably damaging	Het
Ptprq	A	G	10: 107,686,392		probably benign	Het
Rad17	G	A	13: 100,622,863	A552V	possibly damaging	Het
Rbbp8	A	G	18: 11,718,868	T249A	probably benign	Het
Rtkn	A	T	6: 83,135,976	I10F	probably benign	Het
Scube2	T	A	7: 109,857,590	I103F	possibly damaging	Het
Sec23b	A	G	2: 144,581,973	H514R	probably benign	Het
Serbp1	T	A	6: 67,272,220	D223E	probably benign	Het
Slc14a1	C	A	18: 78,111,392	V260L	probably benign	Het
Slc22a23	A	G	13: 34,183,126	I633T	probably damaging	Het
Stk19	A	T	17: 34,824,747		probably benign	Het
Svs2	T	C	2: 164,237,127	M287V	probably benign	Het
Syne3	T	A	12: 104,958,066	Q358L	probably damaging	Het
Synj1	A	G	16: 91,010,096	F58L	possibly damaging	Het
Tg	T	C	15: 66,674,023	V198A	probably damaging	Het
Tle4	A	T	19: 14,597,388	Y9N	probably damaging	Het
Tmem57	A	G	4: 134,804,481	Y626H	probably damaging	Het
Tmx3	G	A	18: 90,524,335	A186T	possibly damaging	Het
Traf3	G	A	12: 111,255,245	S280N	possibly damaging	Het
Trmt13	A	G	3: 116,581,518	F447S	probably damaging	Het
Trp53bp1	T	A	2: 121,228,626	H918L	probably damaging	Het
Ush2a	T	G	1: 188,728,504	V2654G	probably benign	Het
Vmn2r25	A	G	6: 123,840,098	Y175H	probably damaging	Het
Zfp335	T	C	2: 164,892,189	D1330G	probably damaging	Het

Other mutations in Nr2c2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00596:Nr2c2	APN	6	92149719	missense	probably damaging	1.00
IGL01129:Nr2c2	APN	6	92158416	missense	probably benign	0.08
IGL01578:Nr2c2	APN	6	92162038	missense	probably benign	0.01
IGL02281:Nr2c2	APN	6	92154514	missense	probably benign	0.20
R1385:Nr2c2	UTSW	6	92154470	missense	probably damaging	1.00
R1397:Nr2c2	UTSW	6	92149764	missense	probably benign	0.34
R1503:Nr2c2	UTSW	6	92105331	missense	probably benign
R1691:Nr2c2	UTSW	6	92156692	missense	probably damaging	0.99
R1779:Nr2c2	UTSW	6	92159243	missense	possibly damaging	0.50
R2655:Nr2c2	UTSW	6	92163138	missense	probably damaging	0.99
R3840:Nr2c2	UTSW	6	92163138	missense	probably damaging	0.99
R3841:Nr2c2	UTSW	6	92163138	missense	probably damaging	0.99
R3923:Nr2c2	UTSW	6	92160401	missense	probably damaging	0.98
R3926:Nr2c2	UTSW	6	92160401	missense	probably damaging	0.98
R3945:Nr2c2	UTSW	6	92163138	missense	probably damaging	0.99
R4721:Nr2c2	UTSW	6	92139847	missense	possibly damaging	0.49
R5038:Nr2c2	UTSW	6	92139822	missense	probably damaging	1.00
R5101:Nr2c2	UTSW	6	92154516	critical splice donor site	probably null
R5524:Nr2c2	UTSW	6	92139765	splice site	probably null
R6884:Nr2c2	UTSW	6	92158393	missense	probably benign	0.05
R7046:Nr2c2	UTSW	6	92158357	missense	probably damaging	1.00
R7278:Nr2c2	UTSW	6	92159378	missense	probably damaging	0.96
R7316:Nr2c2	UTSW	6	92154463	missense	probably damaging	0.99
R9238:Nr2c2	UTSW	6	92167549	missense	probably damaging	1.00
R9497:Nr2c2	UTSW	6	92156692	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- TCTGGAAATGCAGCCCTTG -3'
(R):5'- TCCCCAGGAACATTTCTTTAGGG -3'

Sequencing Primer
(F):5'- GCCCTTGACAAGCTTGAAATG -3'
(R):5'- AGGGCTTTCCTACACAACTGATG -3'

Posted On

2015-04-17