Incidental Mutation 'R3946:Vmn2r25'
ID307708
Institutional Source Beutler Lab
Gene Symbol Vmn2r25
Ensembl Gene ENSMUSG00000094672
Gene Namevomeronasal 2, receptor 25
SynonymsEG545874
MMRRC Submission 040827-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R3946 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location123822814-123853190 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123840098 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 175 (Y175H)
Ref Sequence ENSEMBL: ENSMUSP00000124342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162046]
Predicted Effect probably damaging
Transcript: ENSMUST00000162046
AA Change: Y175H

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124342
Gene: ENSMUSG00000094672
AA Change: Y175H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 473 6e-31 PFAM
Pfam:NCD3G 519 572 5.8e-25 PFAM
Pfam:7tm_3 603 840 4.8e-55 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 T C 13: 64,309,098 I104V probably damaging Het
Abi2 A G 1: 60,453,754 Q328R probably damaging Het
Agr3 C A 12: 35,947,513 probably benign Het
Brca2 T A 5: 150,536,704 S481R probably damaging Het
Cabin1 T G 10: 75,745,259 Q411P probably damaging Het
Calr3 A G 8: 72,443,620 Y22H probably damaging Het
Caprin1 T A 2: 103,796,766 I59F probably damaging Het
Cdk5rap1 T C 2: 154,348,716 T442A probably damaging Het
Chn2 T C 6: 54,269,426 probably benign Het
Cic C A 7: 25,272,346 R501S possibly damaging Het
Coch A G 12: 51,601,812 probably null Het
Defa25 G A 8: 21,084,490 V17I probably null Het
Dglucy T C 12: 100,838,700 probably null Het
Dtx1 T G 5: 120,681,286 T616P possibly damaging Het
Eef1g T C 19: 8,969,977 L171P probably benign Het
Fam135a A G 1: 24,030,394 S465P probably damaging Het
Gm14025 A G 2: 129,039,601 L135P probably damaging Het
Gm14412 A T 2: 177,314,685 C472* probably null Het
Gm7104 T C 12: 88,286,042 noncoding transcript Het
Got2 A G 8: 95,888,230 S26P probably benign Het
H2-M11 A G 17: 36,549,231 I329M probably damaging Het
Hmcn2 T A 2: 31,382,394 D1295E possibly damaging Het
Hoxd12 G T 2: 74,675,427 R114L probably damaging Het
Ilkap A C 1: 91,387,250 D124E probably damaging Het
Med6 T C 12: 81,581,851 Y88C probably damaging Het
Mep1a A T 17: 43,475,041 L719* probably null Het
Mmp23 T C 4: 155,652,023 Y187C probably damaging Het
Myo1g A G 11: 6,520,760 M32T possibly damaging Het
Ncstn T C 1: 172,067,494 E614G probably benign Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr1309 G A 2: 111,983,297 T259M possibly damaging Het
Otub2 T A 12: 103,392,826 L58* probably null Het
Pcdhga12 G A 18: 37,767,629 V505I probably benign Het
Pcdhga9 T A 18: 37,737,844 V242D probably damaging Het
Pex1 C T 5: 3,626,084 L891F probably damaging Het
Pgm1 C T 5: 64,112,061 T497I probably benign Het
Pikfyve T C 1: 65,196,681 F171L probably damaging Het
Pilrb1 T G 5: 137,857,392 K79T probably benign Het
Pin1 C T 9: 20,655,364 R21W probably damaging Het
Ptprq A G 10: 107,686,392 probably benign Het
Rad17 G A 13: 100,622,863 A552V possibly damaging Het
Rbbp8 A G 18: 11,718,868 T249A probably benign Het
Rtkn A T 6: 83,135,976 I10F probably benign Het
Scube2 T A 7: 109,857,590 I103F possibly damaging Het
Sec23b A G 2: 144,581,973 H514R probably benign Het
Serbp1 T A 6: 67,272,220 D223E probably benign Het
Slc14a1 C A 18: 78,111,392 V260L probably benign Het
Slc22a23 A G 13: 34,183,126 I633T probably damaging Het
Stk19 A T 17: 34,824,747 probably benign Het
Svs2 T C 2: 164,237,127 M287V probably benign Het
Syne3 T A 12: 104,958,066 Q358L probably damaging Het
Synj1 A G 16: 91,010,096 F58L possibly damaging Het
Tg T C 15: 66,674,023 V198A probably damaging Het
Tle4 A T 19: 14,597,388 Y9N probably damaging Het
Tmem57 A G 4: 134,804,481 Y626H probably damaging Het
Tmx3 G A 18: 90,524,335 A186T possibly damaging Het
Traf3 G A 12: 111,255,245 S280N possibly damaging Het
Trmt13 A G 3: 116,581,518 F447S probably damaging Het
Trp53bp1 T A 2: 121,228,626 H918L probably damaging Het
Ush2a T G 1: 188,728,504 V2654G probably benign Het
Zfp335 T C 2: 164,892,189 D1330G probably damaging Het
Other mutations in Vmn2r25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Vmn2r25 APN 6 123853171 missense probably benign 0.25
IGL01781:Vmn2r25 APN 6 123839365 missense possibly damaging 0.48
IGL01843:Vmn2r25 APN 6 123853003 missense possibly damaging 0.67
IGL02023:Vmn2r25 APN 6 123839429 missense probably damaging 0.96
IGL02502:Vmn2r25 APN 6 123839433 missense probably damaging 0.96
IGL02709:Vmn2r25 APN 6 123839764 missense possibly damaging 0.50
IGL03053:Vmn2r25 APN 6 123823118 missense probably damaging 1.00
PIT4468001:Vmn2r25 UTSW 6 123839598 missense probably benign 0.00
PIT4812001:Vmn2r25 UTSW 6 123823488 missense probably damaging 1.00
R0054:Vmn2r25 UTSW 6 123853025 missense probably benign 0.00
R0312:Vmn2r25 UTSW 6 123828580 splice site probably benign
R0366:Vmn2r25 UTSW 6 123823622 nonsense probably null
R0390:Vmn2r25 UTSW 6 123823181 missense probably damaging 1.00
R0466:Vmn2r25 UTSW 6 123852049 missense probably benign 0.16
R0541:Vmn2r25 UTSW 6 123839827 missense probably damaging 0.97
R0612:Vmn2r25 UTSW 6 123839522 missense probably damaging 1.00
R0865:Vmn2r25 UTSW 6 123853017 missense probably benign 0.09
R1219:Vmn2r25 UTSW 6 123839323 missense probably benign 0.00
R1240:Vmn2r25 UTSW 6 123851905 missense probably damaging 0.98
R1701:Vmn2r25 UTSW 6 123851795 splice site probably null
R1780:Vmn2r25 UTSW 6 123828465 missense probably damaging 1.00
R1809:Vmn2r25 UTSW 6 123825378 missense probably benign 0.00
R1833:Vmn2r25 UTSW 6 123839684 missense probably benign 0.01
R1964:Vmn2r25 UTSW 6 123823295 missense possibly damaging 0.94
R2154:Vmn2r25 UTSW 6 123839846 missense probably benign 0.01
R2164:Vmn2r25 UTSW 6 123839559 missense possibly damaging 0.96
R3799:Vmn2r25 UTSW 6 123853184 missense probably benign 0.12
R3836:Vmn2r25 UTSW 6 123853085 missense probably damaging 1.00
R4282:Vmn2r25 UTSW 6 123823647 missense probably damaging 1.00
R4367:Vmn2r25 UTSW 6 123828537 missense probably damaging 1.00
R4438:Vmn2r25 UTSW 6 123839797 missense probably benign 0.03
R4488:Vmn2r25 UTSW 6 123822860 missense probably damaging 1.00
R4580:Vmn2r25 UTSW 6 123823023 missense possibly damaging 0.46
R4631:Vmn2r25 UTSW 6 123853003 missense possibly damaging 0.94
R4765:Vmn2r25 UTSW 6 123823223 missense probably damaging 1.00
R4908:Vmn2r25 UTSW 6 123828447 missense probably benign
R5207:Vmn2r25 UTSW 6 123840103 missense probably damaging 1.00
R5254:Vmn2r25 UTSW 6 123825318 missense probably damaging 1.00
R5444:Vmn2r25 UTSW 6 123828492 missense probably benign 0.00
R5586:Vmn2r25 UTSW 6 123825296 missense probably damaging 1.00
R5607:Vmn2r25 UTSW 6 123828359 missense possibly damaging 0.49
R5985:Vmn2r25 UTSW 6 123823628 missense probably benign
R6046:Vmn2r25 UTSW 6 123822917 missense probably damaging 1.00
R6057:Vmn2r25 UTSW 6 123822941 missense possibly damaging 0.69
R6569:Vmn2r25 UTSW 6 123851982 missense probably benign 0.01
R6826:Vmn2r25 UTSW 6 123823112 missense probably damaging 1.00
R7054:Vmn2r25 UTSW 6 123823610 missense probably damaging 1.00
R7120:Vmn2r25 UTSW 6 123828435 missense possibly damaging 0.51
R7177:Vmn2r25 UTSW 6 123839923 missense possibly damaging 0.94
R7287:Vmn2r25 UTSW 6 123852081 missense possibly damaging 0.49
R7397:Vmn2r25 UTSW 6 123823539 missense probably damaging 0.96
R7486:Vmn2r25 UTSW 6 123823142 missense probably damaging 1.00
R7699:Vmn2r25 UTSW 6 123839923 missense possibly damaging 0.94
R7700:Vmn2r25 UTSW 6 123839923 missense possibly damaging 0.94
R7759:Vmn2r25 UTSW 6 123823380 missense probably damaging 0.99
R7802:Vmn2r25 UTSW 6 123851832 missense possibly damaging 0.88
R7850:Vmn2r25 UTSW 6 123828472 missense probably damaging 1.00
R7933:Vmn2r25 UTSW 6 123828472 missense probably damaging 1.00
R8064:Vmn2r25 UTSW 6 123823622 nonsense probably null
R8170:Vmn2r25 UTSW 6 123853017 missense probably benign 0.09
X0020:Vmn2r25 UTSW 6 123839400 missense possibly damaging 0.95
Z1176:Vmn2r25 UTSW 6 123822897 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCTAAGATAGAGTTCTCCCC -3'
(R):5'- AGGAAATAGATACTCTCTGACTGTG -3'

Sequencing Primer
(F):5'- AGATAGAGTTCTCCCCTCATATCATC -3'
(R):5'- ACTCTCTGACTGTGTTTTGTATGTTC -3'
Posted On2015-04-17