Incidental Mutation 'R3946:Cic'
ID307709
Institutional Source Beutler Lab
Gene Symbol Cic
Ensembl Gene ENSMUSG00000005442
Gene Namecapicua transcriptional repressor
Synonyms1200010B10Rik
MMRRC Submission 040827-MU
Accession Numbers

Genbank: NM_027882.3, NM_001110131.1, NM_001110132.1; Ensembl: ENSMUST00000169266

Is this an essential gene? Probably essential (E-score: 0.894) question?
Stock #R3946 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location25267704-25294159 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 25272346 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 501 (R501S)
Ref Sequence ENSEMBL: ENSMUSP00000132351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169266] [ENSMUST00000169392]
Predicted Effect possibly damaging
Transcript: ENSMUST00000169266
AA Change: R501S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132351
Gene: ENSMUSG00000005442
AA Change: R501S

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
low complexity region 33 73 N/A INTRINSIC
low complexity region 151 165 N/A INTRINSIC
Pfam:DUF4819 249 346 1.8e-23 PFAM
low complexity region 351 367 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
low complexity region 445 457 N/A INTRINSIC
low complexity region 462 475 N/A INTRINSIC
low complexity region 618 633 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 724 734 N/A INTRINSIC
low complexity region 740 751 N/A INTRINSIC
low complexity region 779 786 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
low complexity region 898 911 N/A INTRINSIC
PDB:4J2L|D 930 955 5e-10 PDB
low complexity region 1013 1027 N/A INTRINSIC
low complexity region 1031 1045 N/A INTRINSIC
HMG 1106 1176 1.24e-17 SMART
low complexity region 1322 1338 N/A INTRINSIC
low complexity region 1380 1393 N/A INTRINSIC
low complexity region 1415 1428 N/A INTRINSIC
low complexity region 1432 1462 N/A INTRINSIC
low complexity region 1474 1490 N/A INTRINSIC
low complexity region 1552 1567 N/A INTRINSIC
low complexity region 1636 1647 N/A INTRINSIC
low complexity region 1689 1710 N/A INTRINSIC
low complexity region 1744 1766 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
low complexity region 1971 1986 N/A INTRINSIC
low complexity region 2024 2038 N/A INTRINSIC
low complexity region 2041 2061 N/A INTRINSIC
low complexity region 2129 2159 N/A INTRINSIC
low complexity region 2186 2219 N/A INTRINSIC
low complexity region 2311 2324 N/A INTRINSIC
low complexity region 2389 2400 N/A INTRINSIC
low complexity region 2430 2453 N/A INTRINSIC
low complexity region 2474 2509 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169392
SMART Domains Protein: ENSMUSP00000131680
Gene: ENSMUSG00000005442

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
low complexity region 33 73 N/A INTRINSIC
Meta Mutation Damage Score 0.154 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ortholog of the Drosophila melanogaster capicua gene, and is a member of the high mobility group (HMG)-box superfamily of transcriptional repressors. This protein contains a conserved HMG domain that is involved in DNA binding and nuclear localization, and a conserved C-terminus. Studies suggest that the N-terminal region of this protein interacts with Atxn1 (GeneID:6310), to form a transcription repressor complex, and in vitro studies suggest that polyglutamine-expansion of ATXN1 may alter the repressor activity of this complex. Mutations in this gene have been associated with olidogdendrogliomas (PMID:21817013). In addition, translocation events resulting in gene fusions of this gene with both DUX4 (GeneID:100288687) and FOXO4 (GeneID:4303) have been associated with round cell sarcomas. There are multiple pseudogenes of this gene found on chromosomes 1, 4, 6, 7, 16, 20, and the Y chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit partial postnatal lethality, decreased body size, and severe lung alveolarization defects. [provided by MGI curators]
Allele List at MGI

All alleles(61) : Targeted, other(4) Gene trapped(57)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 T C 13: 64,309,098 I104V probably damaging Het
Abi2 A G 1: 60,453,754 Q328R probably damaging Het
Agr3 C A 12: 35,947,513 probably benign Het
Brca2 T A 5: 150,536,704 S481R probably damaging Het
Cabin1 T G 10: 75,745,259 Q411P probably damaging Het
Calr3 A G 8: 72,443,620 Y22H probably damaging Het
Caprin1 T A 2: 103,796,766 I59F probably damaging Het
Cdk5rap1 T C 2: 154,348,716 T442A probably damaging Het
Chn2 T C 6: 54,269,426 probably benign Het
Coch A G 12: 51,601,812 probably null Het
Defa25 G A 8: 21,084,490 V17I probably null Het
Dglucy T C 12: 100,838,700 probably null Het
Dtx1 T G 5: 120,681,286 T616P possibly damaging Het
Eef1g T C 19: 8,969,977 L171P probably benign Het
Fam135a A G 1: 24,030,394 S465P probably damaging Het
Gm14025 A G 2: 129,039,601 L135P probably damaging Het
Gm14412 A T 2: 177,314,685 C472* probably null Het
Gm7104 T C 12: 88,286,042 noncoding transcript Het
Got2 A G 8: 95,888,230 S26P probably benign Het
H2-M11 A G 17: 36,549,231 I329M probably damaging Het
Hmcn2 T A 2: 31,382,394 D1295E possibly damaging Het
Hoxd12 G T 2: 74,675,427 R114L probably damaging Het
Ilkap A C 1: 91,387,250 D124E probably damaging Het
Med6 T C 12: 81,581,851 Y88C probably damaging Het
Mep1a A T 17: 43,475,041 L719* probably null Het
Mmp23 T C 4: 155,652,023 Y187C probably damaging Het
Myo1g A G 11: 6,520,760 M32T possibly damaging Het
Ncstn T C 1: 172,067,494 E614G probably benign Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr1309 G A 2: 111,983,297 T259M possibly damaging Het
Otub2 T A 12: 103,392,826 L58* probably null Het
Pcdhga12 G A 18: 37,767,629 V505I probably benign Het
Pcdhga9 T A 18: 37,737,844 V242D probably damaging Het
Pex1 C T 5: 3,626,084 L891F probably damaging Het
Pgm1 C T 5: 64,112,061 T497I probably benign Het
Pikfyve T C 1: 65,196,681 F171L probably damaging Het
Pilrb1 T G 5: 137,857,392 K79T probably benign Het
Pin1 C T 9: 20,655,364 R21W probably damaging Het
Ptprq A G 10: 107,686,392 probably benign Het
Rad17 G A 13: 100,622,863 A552V possibly damaging Het
Rbbp8 A G 18: 11,718,868 T249A probably benign Het
Rtkn A T 6: 83,135,976 I10F probably benign Het
Scube2 T A 7: 109,857,590 I103F possibly damaging Het
Sec23b A G 2: 144,581,973 H514R probably benign Het
Serbp1 T A 6: 67,272,220 D223E probably benign Het
Slc14a1 C A 18: 78,111,392 V260L probably benign Het
Slc22a23 A G 13: 34,183,126 I633T probably damaging Het
Stk19 A T 17: 34,824,747 probably benign Het
Svs2 T C 2: 164,237,127 M287V probably benign Het
Syne3 T A 12: 104,958,066 Q358L probably damaging Het
Synj1 A G 16: 91,010,096 F58L possibly damaging Het
Tg T C 15: 66,674,023 V198A probably damaging Het
Tle4 A T 19: 14,597,388 Y9N probably damaging Het
Tmem57 A G 4: 134,804,481 Y626H probably damaging Het
Tmx3 G A 18: 90,524,335 A186T possibly damaging Het
Traf3 G A 12: 111,255,245 S280N possibly damaging Het
Trmt13 A G 3: 116,581,518 F447S probably damaging Het
Trp53bp1 T A 2: 121,228,626 H918L probably damaging Het
Ush2a T G 1: 188,728,504 V2654G probably benign Het
Vmn2r25 A G 6: 123,840,098 Y175H probably damaging Het
Zfp335 T C 2: 164,892,189 D1330G probably damaging Het
Other mutations in Cic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cic APN 7 25292124 missense probably damaging 1.00
IGL01668:Cic APN 7 25291204 missense possibly damaging 0.47
IGL02229:Cic APN 7 25290950 missense probably damaging 0.96
IGL02506:Cic APN 7 25290857 missense probably benign
IGL02794:Cic APN 7 25285644 missense probably damaging 1.00
IGL03065:Cic APN 7 25285821 splice site probably benign
IGL03304:Cic APN 7 25284849 missense probably damaging 1.00
1mM(1):Cic UTSW 7 25290789 splice site probably benign
IGL03046:Cic UTSW 7 25291075 missense probably damaging 1.00
R0012:Cic UTSW 7 25287140 missense probably damaging 0.98
R0012:Cic UTSW 7 25287141 missense probably damaging 1.00
R0027:Cic UTSW 7 25287140 missense probably damaging 0.98
R0027:Cic UTSW 7 25287141 missense probably damaging 1.00
R0038:Cic UTSW 7 25287140 missense probably damaging 0.98
R0038:Cic UTSW 7 25287141 missense probably damaging 1.00
R0063:Cic UTSW 7 25287140 missense probably damaging 0.98
R0063:Cic UTSW 7 25287141 missense probably damaging 1.00
R0064:Cic UTSW 7 25287140 missense probably damaging 0.98
R0064:Cic UTSW 7 25287141 missense probably damaging 1.00
R0118:Cic UTSW 7 25286034 missense probably damaging 1.00
R0193:Cic UTSW 7 25287140 missense probably damaging 0.98
R0193:Cic UTSW 7 25287141 missense probably damaging 1.00
R0241:Cic UTSW 7 25287140 missense probably damaging 0.98
R0241:Cic UTSW 7 25287141 missense probably damaging 1.00
R0377:Cic UTSW 7 25285799 missense probably damaging 0.98
R0462:Cic UTSW 7 25287140 missense probably damaging 0.98
R0462:Cic UTSW 7 25287141 missense probably damaging 1.00
R0800:Cic UTSW 7 25285237 missense probably benign
R1253:Cic UTSW 7 25290948 missense probably damaging 1.00
R1458:Cic UTSW 7 25279737 intron probably benign
R1462:Cic UTSW 7 25271607 missense probably damaging 0.98
R1462:Cic UTSW 7 25271607 missense probably damaging 0.98
R1519:Cic UTSW 7 25293810 critical splice acceptor site probably null
R1586:Cic UTSW 7 25285961 missense probably damaging 1.00
R1824:Cic UTSW 7 25288266 missense probably damaging 1.00
R1908:Cic UTSW 7 25286840 missense probably damaging 1.00
R2045:Cic UTSW 7 25271536 missense possibly damaging 0.53
R2063:Cic UTSW 7 25273451 missense probably damaging 0.98
R2161:Cic UTSW 7 25288134 unclassified probably null
R2495:Cic UTSW 7 25291776 splice site probably benign
R2865:Cic UTSW 7 25273221 missense probably damaging 0.96
R3692:Cic UTSW 7 25288913 nonsense probably null
R3709:Cic UTSW 7 25286981 missense probably damaging 0.99
R3710:Cic UTSW 7 25286981 missense probably damaging 0.99
R3872:Cic UTSW 7 25271699 missense possibly damaging 0.92
R4199:Cic UTSW 7 25291670 frame shift probably null
R4426:Cic UTSW 7 25294008 utr 3 prime probably benign
R4502:Cic UTSW 7 25288467 missense probably damaging 1.00
R4585:Cic UTSW 7 25272778 missense probably benign 0.33
R4586:Cic UTSW 7 25272778 missense probably benign 0.33
R4614:Cic UTSW 7 25291670 frame shift probably null
R4664:Cic UTSW 7 25290674 small deletion probably benign
R4688:Cic UTSW 7 25291670 frame shift probably null
R4695:Cic UTSW 7 25273588 missense possibly damaging 0.72
R4696:Cic UTSW 7 25288483 missense probably benign
R4746:Cic UTSW 7 25288480 missense probably damaging 1.00
R4758:Cic UTSW 7 25292211 missense possibly damaging 0.62
R4767:Cic UTSW 7 25271600 missense possibly damaging 0.92
R4776:Cic UTSW 7 25282883 missense possibly damaging 0.95
R4820:Cic UTSW 7 25271732 missense possibly damaging 0.92
R4850:Cic UTSW 7 25272902 missense probably damaging 0.98
R4851:Cic UTSW 7 25272902 missense probably damaging 0.98
R4922:Cic UTSW 7 25291670 small insertion probably benign
R4989:Cic UTSW 7 25287110 missense probably damaging 1.00
R5131:Cic UTSW 7 25291670 small insertion probably benign
R5718:Cic UTSW 7 25272778 missense probably benign 0.33
R5801:Cic UTSW 7 25271438 missense possibly damaging 0.93
R5949:Cic UTSW 7 25272305 missense probably damaging 1.00
R6000:Cic UTSW 7 25271998 missense probably benign 0.33
R6246:Cic UTSW 7 25271642 missense probably damaging 1.00
R6283:Cic UTSW 7 25286034 missense probably damaging 1.00
R6364:Cic UTSW 7 25272823 missense possibly damaging 0.72
R6481:Cic UTSW 7 25288281 missense possibly damaging 0.56
R6919:Cic UTSW 7 25271777 missense probably benign 0.04
R6920:Cic UTSW 7 25290682 missense probably damaging 1.00
R6995:Cic UTSW 7 25271311 missense possibly damaging 0.53
R7002:Cic UTSW 7 25272196 missense probably damaging 0.99
R7113:Cic UTSW 7 25273444 missense probably benign 0.08
R7560:Cic UTSW 7 25272853 missense probably damaging 0.98
V7732:Cic UTSW 7 25292245 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTCCAACATCAGCTTTGGTAG -3'
(R):5'- CCAGTCAAACTCAGTGCTTCC -3'

Sequencing Primer
(F):5'- CTTTGGTAGCAACCTGGGGAC -3'
(R):5'- AAACTCAGTGCTTCCTTCCCGG -3'
Posted On2015-04-17