Incidental Mutation 'R3946:Calr3'
ID307711
Institutional Source Beutler Lab
Gene Symbol Calr3
Ensembl Gene ENSMUSG00000019732
Gene Namecalreticulin 3
SynonymsCrt2, 6330586I20Rik, calsperin, 1700031L01Rik
MMRRC Submission 040827-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R3946 (G1)
Quality Score148
Status Validated
Chromosome8
Chromosomal Location72424176-72443870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72443620 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 22 (Y22H)
Ref Sequence ENSEMBL: ENSMUSP00000019876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019876] [ENSMUST00000064853] [ENSMUST00000121902]
Predicted Effect probably damaging
Transcript: ENSMUST00000019876
AA Change: Y22H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019876
Gene: ENSMUSG00000019732
AA Change: Y22H

DomainStartEndE-ValueType
Pfam:Calreticulin 23 256 5.7e-40 PFAM
Pfam:Calreticulin 255 315 6.6e-7 PFAM
low complexity region 345 359 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064853
SMART Domains Protein: ENSMUSP00000063244
Gene: ENSMUSG00000052794

DomainStartEndE-ValueType
low complexity region 200 216 N/A INTRINSIC
low complexity region 250 262 N/A INTRINSIC
low complexity region 320 333 N/A INTRINSIC
low complexity region 374 383 N/A INTRINSIC
low complexity region 421 432 N/A INTRINSIC
Pfam:DUF4614 438 608 2e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121902
SMART Domains Protein: ENSMUSP00000113279
Gene: ENSMUSG00000052794

DomainStartEndE-ValueType
low complexity region 200 216 N/A INTRINSIC
low complexity region 250 262 N/A INTRINSIC
low complexity region 320 333 N/A INTRINSIC
low complexity region 387 398 N/A INTRINSIC
Pfam:DUF4614 400 575 1.3e-75 PFAM
Meta Mutation Damage Score 0.1979 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the calreticulin family, members of which are calcium-binding chaperones localized mainly in the endoplasmic reticulum. This protein is also localized to the endoplasmic reticulum lumen, however, its capacity for calcium-binding may be absent or much lower than other family members. This gene is specifically expressed in the testis, and may be required for sperm fertility. Mutation in this gene has been associated with familial hypertrophic cardiomyopathy. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility associated with impaired zona pellucida binding and fertilization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 T C 13: 64,309,098 I104V probably damaging Het
Abi2 A G 1: 60,453,754 Q328R probably damaging Het
Agr3 C A 12: 35,947,513 probably benign Het
Brca2 T A 5: 150,536,704 S481R probably damaging Het
Cabin1 T G 10: 75,745,259 Q411P probably damaging Het
Caprin1 T A 2: 103,796,766 I59F probably damaging Het
Cdk5rap1 T C 2: 154,348,716 T442A probably damaging Het
Chn2 T C 6: 54,269,426 probably benign Het
Cic C A 7: 25,272,346 R501S possibly damaging Het
Coch A G 12: 51,601,812 probably null Het
Defa25 G A 8: 21,084,490 V17I probably null Het
Dglucy T C 12: 100,838,700 probably null Het
Dtx1 T G 5: 120,681,286 T616P possibly damaging Het
Eef1g T C 19: 8,969,977 L171P probably benign Het
Fam135a A G 1: 24,030,394 S465P probably damaging Het
Gm14025 A G 2: 129,039,601 L135P probably damaging Het
Gm14412 A T 2: 177,314,685 C472* probably null Het
Gm7104 T C 12: 88,286,042 noncoding transcript Het
Got2 A G 8: 95,888,230 S26P probably benign Het
H2-M11 A G 17: 36,549,231 I329M probably damaging Het
Hmcn2 T A 2: 31,382,394 D1295E possibly damaging Het
Hoxd12 G T 2: 74,675,427 R114L probably damaging Het
Ilkap A C 1: 91,387,250 D124E probably damaging Het
Med6 T C 12: 81,581,851 Y88C probably damaging Het
Mep1a A T 17: 43,475,041 L719* probably null Het
Mmp23 T C 4: 155,652,023 Y187C probably damaging Het
Myo1g A G 11: 6,520,760 M32T possibly damaging Het
Ncstn T C 1: 172,067,494 E614G probably benign Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr1309 G A 2: 111,983,297 T259M possibly damaging Het
Otub2 T A 12: 103,392,826 L58* probably null Het
Pcdhga12 G A 18: 37,767,629 V505I probably benign Het
Pcdhga9 T A 18: 37,737,844 V242D probably damaging Het
Pex1 C T 5: 3,626,084 L891F probably damaging Het
Pgm1 C T 5: 64,112,061 T497I probably benign Het
Pikfyve T C 1: 65,196,681 F171L probably damaging Het
Pilrb1 T G 5: 137,857,392 K79T probably benign Het
Pin1 C T 9: 20,655,364 R21W probably damaging Het
Ptprq A G 10: 107,686,392 probably benign Het
Rad17 G A 13: 100,622,863 A552V possibly damaging Het
Rbbp8 A G 18: 11,718,868 T249A probably benign Het
Rtkn A T 6: 83,135,976 I10F probably benign Het
Scube2 T A 7: 109,857,590 I103F possibly damaging Het
Sec23b A G 2: 144,581,973 H514R probably benign Het
Serbp1 T A 6: 67,272,220 D223E probably benign Het
Slc14a1 C A 18: 78,111,392 V260L probably benign Het
Slc22a23 A G 13: 34,183,126 I633T probably damaging Het
Stk19 A T 17: 34,824,747 probably benign Het
Svs2 T C 2: 164,237,127 M287V probably benign Het
Syne3 T A 12: 104,958,066 Q358L probably damaging Het
Synj1 A G 16: 91,010,096 F58L possibly damaging Het
Tg T C 15: 66,674,023 V198A probably damaging Het
Tle4 A T 19: 14,597,388 Y9N probably damaging Het
Tmem57 A G 4: 134,804,481 Y626H probably damaging Het
Tmx3 G A 18: 90,524,335 A186T possibly damaging Het
Traf3 G A 12: 111,255,245 S280N possibly damaging Het
Trmt13 A G 3: 116,581,518 F447S probably damaging Het
Trp53bp1 T A 2: 121,228,626 H918L probably damaging Het
Ush2a T G 1: 188,728,504 V2654G probably benign Het
Vmn2r25 A G 6: 123,840,098 Y175H probably damaging Het
Zfp335 T C 2: 164,892,189 D1330G probably damaging Het
Other mutations in Calr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Calr3 APN 8 72431396 nonsense probably null
IGL01358:Calr3 APN 8 72427213 nonsense probably null
IGL02440:Calr3 APN 8 72431432 missense probably benign 0.30
IGL02646:Calr3 APN 8 72443460 missense possibly damaging 0.89
IGL02882:Calr3 APN 8 72434821 missense probably damaging 0.99
IGL02945:Calr3 APN 8 72438557 missense probably damaging 1.00
IGL03025:Calr3 APN 8 72434891 splice site probably benign
IGL03175:Calr3 APN 8 72443605 missense probably damaging 1.00
R0140:Calr3 UTSW 8 72434888 splice site probably benign
R1518:Calr3 UTSW 8 72427200 missense probably damaging 0.97
R1675:Calr3 UTSW 8 72431458 missense probably damaging 1.00
R2006:Calr3 UTSW 8 72434851 missense probably damaging 1.00
R2111:Calr3 UTSW 8 72427268 missense probably damaging 0.99
R2202:Calr3 UTSW 8 72434839 missense probably damaging 1.00
R2296:Calr3 UTSW 8 72424625 unclassified probably benign
R2432:Calr3 UTSW 8 72438426 unclassified probably benign
R4382:Calr3 UTSW 8 72428164 missense probably damaging 1.00
R4383:Calr3 UTSW 8 72428164 missense probably damaging 1.00
R4384:Calr3 UTSW 8 72428164 missense probably damaging 1.00
R4385:Calr3 UTSW 8 72428164 missense probably damaging 1.00
R4943:Calr3 UTSW 8 72431377 missense probably benign 0.18
R5132:Calr3 UTSW 8 72431368 splice site probably null
R7337:Calr3 UTSW 8 72431495 missense probably damaging 1.00
R7879:Calr3 UTSW 8 72424643 missense unknown
R8132:Calr3 UTSW 8 72427179 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCCCGATGAGACTCTGAAG -3'
(R):5'- ACGGGACCAGTAATTTCAGC -3'

Sequencing Primer
(F):5'- TCTGAAGTGCCCAAACTGG -3'
(R):5'- GTAATTTCAGCGCACCCATTAG -3'
Posted On2015-04-17