Incidental Mutation 'R3946:Pin1'
ID 307713
Institutional Source Beutler Lab
Gene Symbol Pin1
Ensembl Gene ENSMUSG00000032171
Gene Name protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting 1
Synonyms D9Bwg1161e, 0610025L01Rik
MMRRC Submission 040827-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.805) question?
Stock # R3946 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 20652095-20666584 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 20655364 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 21 (R21W)
Ref Sequence ENSEMBL: ENSMUSP00000034689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034689]
AlphaFold Q9QUR7
Predicted Effect probably damaging
Transcript: ENSMUST00000034689
AA Change: R21W

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034689
Gene: ENSMUSG00000032171
AA Change: R21W

DomainStartEndE-ValueType
WW 6 39 3.57e-14 SMART
Pfam:Rotamase_3 45 165 1.6e-23 PFAM
Pfam:Rotamase 61 165 1.4e-25 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Peptidyl-prolyl cis/trans isomerases (PPIases) catalyze the cis/trans isomerization of peptidyl-prolyl peptide bonds. This gene encodes one of the PPIases, which specifically binds to phosphorylated ser/thr-pro motifs to catalytically regulate the post-phosphorylation conformation of its substrates. The conformational regulation catalyzed by this PPIase has a profound impact on key proteins involved in the regulation of cell growth, genotoxic and other stress responses, the immune response, induction and maintenance of pluripotency, germ cell development, neuronal differentiation, and survival. This enzyme also plays a key role in the pathogenesis of Alzheimer's disease and many cancers. Multiple alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygotes exhibit cell-proliferation abnormalities, including a late-developing reduction in body weight and progressive testicular and retinal atrophies. Mutant females fail to undergo mammary epithelial duct expansion associated with pregnancy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 T C 13: 64,309,098 I104V probably damaging Het
Abi2 A G 1: 60,453,754 Q328R probably damaging Het
Agr3 C A 12: 35,947,513 probably benign Het
Brca2 T A 5: 150,536,704 S481R probably damaging Het
Cabin1 T G 10: 75,745,259 Q411P probably damaging Het
Calr3 A G 8: 72,443,620 Y22H probably damaging Het
Caprin1 T A 2: 103,796,766 I59F probably damaging Het
Cdk5rap1 T C 2: 154,348,716 T442A probably damaging Het
Chn2 T C 6: 54,269,426 probably benign Het
Cic C A 7: 25,272,346 R501S possibly damaging Het
Coch A G 12: 51,601,812 probably null Het
Defa25 G A 8: 21,084,490 V17I probably null Het
Dglucy T C 12: 100,838,700 probably null Het
Dtx1 T G 5: 120,681,286 T616P possibly damaging Het
Eef1g T C 19: 8,969,977 L171P probably benign Het
Fam135a A G 1: 24,030,394 S465P probably damaging Het
Gm14025 A G 2: 129,039,601 L135P probably damaging Het
Gm14412 A T 2: 177,314,685 C472* probably null Het
Gm7104 T C 12: 88,286,042 noncoding transcript Het
Got2 A G 8: 95,888,230 S26P probably benign Het
H2-M11 A G 17: 36,549,231 I329M probably damaging Het
Hmcn2 T A 2: 31,382,394 D1295E possibly damaging Het
Hoxd12 G T 2: 74,675,427 R114L probably damaging Het
Ilkap A C 1: 91,387,250 D124E probably damaging Het
Med6 T C 12: 81,581,851 Y88C probably damaging Het
Mep1a A T 17: 43,475,041 L719* probably null Het
Mmp23 T C 4: 155,652,023 Y187C probably damaging Het
Myo1g A G 11: 6,520,760 M32T possibly damaging Het
Ncstn T C 1: 172,067,494 E614G probably benign Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr1309 G A 2: 111,983,297 T259M possibly damaging Het
Otub2 T A 12: 103,392,826 L58* probably null Het
Pcdhga12 G A 18: 37,767,629 V505I probably benign Het
Pcdhga9 T A 18: 37,737,844 V242D probably damaging Het
Pex1 C T 5: 3,626,084 L891F probably damaging Het
Pgm1 C T 5: 64,112,061 T497I probably benign Het
Pikfyve T C 1: 65,196,681 F171L probably damaging Het
Pilrb1 T G 5: 137,857,392 K79T probably benign Het
Ptprq A G 10: 107,686,392 probably benign Het
Rad17 G A 13: 100,622,863 A552V possibly damaging Het
Rbbp8 A G 18: 11,718,868 T249A probably benign Het
Rtkn A T 6: 83,135,976 I10F probably benign Het
Scube2 T A 7: 109,857,590 I103F possibly damaging Het
Sec23b A G 2: 144,581,973 H514R probably benign Het
Serbp1 T A 6: 67,272,220 D223E probably benign Het
Slc14a1 C A 18: 78,111,392 V260L probably benign Het
Slc22a23 A G 13: 34,183,126 I633T probably damaging Het
Stk19 A T 17: 34,824,747 probably benign Het
Svs2 T C 2: 164,237,127 M287V probably benign Het
Syne3 T A 12: 104,958,066 Q358L probably damaging Het
Synj1 A G 16: 91,010,096 F58L possibly damaging Het
Tg T C 15: 66,674,023 V198A probably damaging Het
Tle4 A T 19: 14,597,388 Y9N probably damaging Het
Tmem57 A G 4: 134,804,481 Y626H probably damaging Het
Tmx3 G A 18: 90,524,335 A186T possibly damaging Het
Traf3 G A 12: 111,255,245 S280N possibly damaging Het
Trmt13 A G 3: 116,581,518 F447S probably damaging Het
Trp53bp1 T A 2: 121,228,626 H918L probably damaging Het
Ush2a T G 1: 188,728,504 V2654G probably benign Het
Vmn2r25 A G 6: 123,840,098 Y175H probably damaging Het
Zfp335 T C 2: 164,892,189 D1330G probably damaging Het
Other mutations in Pin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02696:Pin1 APN 9 20663235 missense probably benign 0.12
R0122:Pin1 UTSW 9 20662304 missense probably benign 0.00
R9366:Pin1 UTSW 9 20655545 missense probably damaging 1.00
X0028:Pin1 UTSW 9 20655389 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATTAGCACAGCCCTACAG -3'
(R):5'- ACCATTGATGAGCTCCAGGG -3'

Sequencing Primer
(F):5'- AGCCCTACAGGTCCCGATG -3'
(R):5'- GTGATCTTTTCCTGCCGCCAG -3'
Posted On 2015-04-17