Incidental Mutation 'R3946:Coch'
ID307719
Institutional Source Beutler Lab
Gene Symbol Coch
Ensembl Gene ENSMUSG00000020953
Gene Namecochlin
SynonymsCoch-5B2, D12H14S564E
MMRRC Submission 040827-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3946 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location51593341-51605771 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 51601812 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085412] [ENSMUST00000085412] [ENSMUST00000164782] [ENSMUST00000164782]
Predicted Effect probably null
Transcript: ENSMUST00000085412
SMART Domains Protein: ENSMUSP00000082533
Gene: ENSMUSG00000020953

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LCCL 32 114 3.64e-47 SMART
VWA 165 337 2.06e-33 SMART
VWA 367 540 6.43e-44 SMART
Predicted Effect probably null
Transcript: ENSMUST00000085412
SMART Domains Protein: ENSMUSP00000082533
Gene: ENSMUSG00000020953

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LCCL 32 114 3.64e-47 SMART
VWA 165 337 2.06e-33 SMART
VWA 367 540 6.43e-44 SMART
Predicted Effect probably null
Transcript: ENSMUST00000164782
SMART Domains Protein: ENSMUSP00000128127
Gene: ENSMUSG00000020953

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LCCL 32 114 3.64e-47 SMART
VWA 165 337 2.06e-33 SMART
VWA 367 540 6.43e-44 SMART
Predicted Effect probably null
Transcript: ENSMUST00000164782
SMART Domains Protein: ENSMUSP00000128127
Gene: ENSMUSG00000020953

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LCCL 32 114 3.64e-47 SMART
VWA 165 337 2.06e-33 SMART
VWA 367 540 6.43e-44 SMART
Meta Mutation Damage Score 0.9481 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly conserved in human, mouse, and chicken, showing 94% and 79% amino acid identity of human to mouse and chicken sequences, respectively. Hybridization to this gene was detected in spindle-shaped cells located along nerve fibers between the auditory ganglion and sensory epithelium. These cells accompany neurites at the habenula perforata, the opening through which neurites extend to innervate hair cells. This and the pattern of expression of this gene in chicken inner ear paralleled the histologic findings of acidophilic deposits, consistent with mucopolysaccharide ground substance, in temporal bones from DFNA9 (autosomal dominant nonsyndromic sensorineural deafness 9) patients. Mutations that cause DFNA9 have been reported in this gene. Alternative splicing results in multiple transcript variants encoding the same protein. Additional splice variants encoding distinct isoforms have been described but their biological validities have not been demonstrated. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for a point mutation have vestibular and hearing dysfunctions that worsen with age. Homozyogtes for a null allele have no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 T C 13: 64,309,098 I104V probably damaging Het
Abi2 A G 1: 60,453,754 Q328R probably damaging Het
Agr3 C A 12: 35,947,513 probably benign Het
Brca2 T A 5: 150,536,704 S481R probably damaging Het
Cabin1 T G 10: 75,745,259 Q411P probably damaging Het
Calr3 A G 8: 72,443,620 Y22H probably damaging Het
Caprin1 T A 2: 103,796,766 I59F probably damaging Het
Cdk5rap1 T C 2: 154,348,716 T442A probably damaging Het
Chn2 T C 6: 54,269,426 probably benign Het
Cic C A 7: 25,272,346 R501S possibly damaging Het
Defa25 G A 8: 21,084,490 V17I probably null Het
Dglucy T C 12: 100,838,700 probably null Het
Dtx1 T G 5: 120,681,286 T616P possibly damaging Het
Eef1g T C 19: 8,969,977 L171P probably benign Het
Fam135a A G 1: 24,030,394 S465P probably damaging Het
Gm14025 A G 2: 129,039,601 L135P probably damaging Het
Gm14412 A T 2: 177,314,685 C472* probably null Het
Gm7104 T C 12: 88,286,042 noncoding transcript Het
Got2 A G 8: 95,888,230 S26P probably benign Het
H2-M11 A G 17: 36,549,231 I329M probably damaging Het
Hmcn2 T A 2: 31,382,394 D1295E possibly damaging Het
Hoxd12 G T 2: 74,675,427 R114L probably damaging Het
Ilkap A C 1: 91,387,250 D124E probably damaging Het
Med6 T C 12: 81,581,851 Y88C probably damaging Het
Mep1a A T 17: 43,475,041 L719* probably null Het
Mmp23 T C 4: 155,652,023 Y187C probably damaging Het
Myo1g A G 11: 6,520,760 M32T possibly damaging Het
Ncstn T C 1: 172,067,494 E614G probably benign Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr1309 G A 2: 111,983,297 T259M possibly damaging Het
Otub2 T A 12: 103,392,826 L58* probably null Het
Pcdhga12 G A 18: 37,767,629 V505I probably benign Het
Pcdhga9 T A 18: 37,737,844 V242D probably damaging Het
Pex1 C T 5: 3,626,084 L891F probably damaging Het
Pgm1 C T 5: 64,112,061 T497I probably benign Het
Pikfyve T C 1: 65,196,681 F171L probably damaging Het
Pilrb1 T G 5: 137,857,392 K79T probably benign Het
Pin1 C T 9: 20,655,364 R21W probably damaging Het
Ptprq A G 10: 107,686,392 probably benign Het
Rad17 G A 13: 100,622,863 A552V possibly damaging Het
Rbbp8 A G 18: 11,718,868 T249A probably benign Het
Rtkn A T 6: 83,135,976 I10F probably benign Het
Scube2 T A 7: 109,857,590 I103F possibly damaging Het
Sec23b A G 2: 144,581,973 H514R probably benign Het
Serbp1 T A 6: 67,272,220 D223E probably benign Het
Slc14a1 C A 18: 78,111,392 V260L probably benign Het
Slc22a23 A G 13: 34,183,126 I633T probably damaging Het
Stk19 A T 17: 34,824,747 probably benign Het
Svs2 T C 2: 164,237,127 M287V probably benign Het
Syne3 T A 12: 104,958,066 Q358L probably damaging Het
Synj1 A G 16: 91,010,096 F58L possibly damaging Het
Tg T C 15: 66,674,023 V198A probably damaging Het
Tle4 A T 19: 14,597,388 Y9N probably damaging Het
Tmem57 A G 4: 134,804,481 Y626H probably damaging Het
Tmx3 G A 18: 90,524,335 A186T possibly damaging Het
Traf3 G A 12: 111,255,245 S280N possibly damaging Het
Trmt13 A G 3: 116,581,518 F447S probably damaging Het
Trp53bp1 T A 2: 121,228,626 H918L probably damaging Het
Ush2a T G 1: 188,728,504 V2654G probably benign Het
Vmn2r25 A G 6: 123,840,098 Y175H probably damaging Het
Zfp335 T C 2: 164,892,189 D1330G probably damaging Het
Other mutations in Coch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01514:Coch APN 12 51603353 missense probably damaging 1.00
IGL01803:Coch APN 12 51603299 missense probably benign 0.15
IGL02613:Coch APN 12 51595349 missense possibly damaging 0.76
IGL02697:Coch APN 12 51597038 missense probably benign 0.00
IGL03351:Coch APN 12 51603206 missense probably benign 0.05
R0732:Coch UTSW 12 51595372 missense probably damaging 1.00
R1485:Coch UTSW 12 51598289 missense probably damaging 1.00
R1757:Coch UTSW 12 51602848 missense probably damaging 1.00
R2073:Coch UTSW 12 51602689 missense probably benign 0.00
R2231:Coch UTSW 12 51602865 missense probably benign
R2440:Coch UTSW 12 51596562 missense probably damaging 0.99
R3104:Coch UTSW 12 51603421 missense probably benign
R3623:Coch UTSW 12 51602826 missense probably benign 0.06
R3624:Coch UTSW 12 51602826 missense probably benign 0.06
R3932:Coch UTSW 12 51603338 missense probably damaging 1.00
R3933:Coch UTSW 12 51603338 missense probably damaging 1.00
R3945:Coch UTSW 12 51601812 critical splice acceptor site probably null
R4423:Coch UTSW 12 51598149 splice site probably null
R4660:Coch UTSW 12 51595485 missense probably benign 0.21
R4732:Coch UTSW 12 51605019 missense probably benign 0.28
R4733:Coch UTSW 12 51605019 missense probably benign 0.28
R4844:Coch UTSW 12 51602694 missense probably damaging 0.98
R4997:Coch UTSW 12 51603181 splice site probably null
R5152:Coch UTSW 12 51595442 missense probably benign 0.00
R5173:Coch UTSW 12 51596507 nonsense probably null
R6134:Coch UTSW 12 51602753 missense probably damaging 1.00
R6481:Coch UTSW 12 51598173 missense probably damaging 1.00
R6497:Coch UTSW 12 51602721 missense probably benign 0.06
R6714:Coch UTSW 12 51602737 missense probably damaging 1.00
R6896:Coch UTSW 12 51602869 missense possibly damaging 0.62
R7242:Coch UTSW 12 51593561 start gained probably benign
R7463:Coch UTSW 12 51593625 start codon destroyed probably null 0.02
R7595:Coch UTSW 12 51598233 missense probably damaging 1.00
R8047:Coch UTSW 12 51603713 critical splice donor site probably null
R8085:Coch UTSW 12 51603248 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TGAGTGGAAGCGATGTCCTAG -3'
(R):5'- GTGCTAGAACTGTCATGAATGTC -3'

Sequencing Primer
(F):5'- GAATCATGTGTGCCCCTGATGC -3'
(R):5'- TGTCATGAAGCATGCGGC -3'
Posted On2015-04-17