Incidental Mutation 'R3946:Traf3'
ID307725
Institutional Source Beutler Lab
Gene Symbol Traf3
Ensembl Gene ENSMUSG00000021277
Gene NameTNF receptor-associated factor 3
SynonymsLAP1, CRAF1, CD40bp, CAP-1
MMRRC Submission 040827-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3946 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location111166370-111267153 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 111255245 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 280 (S280N)
Ref Sequence ENSEMBL: ENSMUSP00000021706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021706] [ENSMUST00000060274] [ENSMUST00000117269]
PDB Structure
Crystal structure of TRAF3/Cardif [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021706
AA Change: S280N

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021706
Gene: ENSMUSG00000021277
AA Change: S280N

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 4.6e-18 PFAM
Pfam:zf-TRAF 191 250 9.9e-14 PFAM
coiled coil region 298 337 N/A INTRINSIC
MATH 419 542 5.69e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060274
AA Change: S255N

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000058361
Gene: ENSMUSG00000021277
AA Change: S255N

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 1.5e-17 PFAM
coiled coil region 273 312 N/A INTRINSIC
MATH 394 517 5.69e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117269
AA Change: S255N

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000112517
Gene: ENSMUSG00000021277
AA Change: S255N

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 1.5e-17 PFAM
coiled coil region 273 312 N/A INTRINSIC
MATH 394 517 5.69e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143395
Meta Mutation Damage Score 0.0733 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from, members of the TNF receptor (TNFR) superfamily. This protein participates in the signal transduction of CD40, a TNFR family member important for the activation of the immune response. This protein is found to be a critical component of the lymphotoxin-beta receptor (LTbetaR) signaling complex, which induces NF-kappaB activation and cell death initiated by LTbeta ligation. Epstein-Barr virus encoded latent infection membrane protein-1 (LMP1) can interact with this and several other members of the TRAF family, which may be essential for the oncogenic effects of LMP1. Several alternatively spliced transcript variants encoding three distinct isoforms have been reported. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous mutation of this gene results in progressive runting, hypoglycemia, and depletion of peripheral white blood cells, leading to death by 10 days of age. Immune responses to T-dependent antigen are impaired in lethally irradiated mice reconstituted with mutant cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 T C 13: 64,309,098 I104V probably damaging Het
Abi2 A G 1: 60,453,754 Q328R probably damaging Het
Agr3 C A 12: 35,947,513 probably benign Het
Brca2 T A 5: 150,536,704 S481R probably damaging Het
Cabin1 T G 10: 75,745,259 Q411P probably damaging Het
Calr3 A G 8: 72,443,620 Y22H probably damaging Het
Caprin1 T A 2: 103,796,766 I59F probably damaging Het
Cdk5rap1 T C 2: 154,348,716 T442A probably damaging Het
Chn2 T C 6: 54,269,426 probably benign Het
Cic C A 7: 25,272,346 R501S possibly damaging Het
Coch A G 12: 51,601,812 probably null Het
Defa25 G A 8: 21,084,490 V17I probably null Het
Dglucy T C 12: 100,838,700 probably null Het
Dtx1 T G 5: 120,681,286 T616P possibly damaging Het
Eef1g T C 19: 8,969,977 L171P probably benign Het
Fam135a A G 1: 24,030,394 S465P probably damaging Het
Gm14025 A G 2: 129,039,601 L135P probably damaging Het
Gm14412 A T 2: 177,314,685 C472* probably null Het
Gm7104 T C 12: 88,286,042 noncoding transcript Het
Got2 A G 8: 95,888,230 S26P probably benign Het
H2-M11 A G 17: 36,549,231 I329M probably damaging Het
Hmcn2 T A 2: 31,382,394 D1295E possibly damaging Het
Hoxd12 G T 2: 74,675,427 R114L probably damaging Het
Ilkap A C 1: 91,387,250 D124E probably damaging Het
Med6 T C 12: 81,581,851 Y88C probably damaging Het
Mep1a A T 17: 43,475,041 L719* probably null Het
Mmp23 T C 4: 155,652,023 Y187C probably damaging Het
Myo1g A G 11: 6,520,760 M32T possibly damaging Het
Ncstn T C 1: 172,067,494 E614G probably benign Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr1309 G A 2: 111,983,297 T259M possibly damaging Het
Otub2 T A 12: 103,392,826 L58* probably null Het
Pcdhga12 G A 18: 37,767,629 V505I probably benign Het
Pcdhga9 T A 18: 37,737,844 V242D probably damaging Het
Pex1 C T 5: 3,626,084 L891F probably damaging Het
Pgm1 C T 5: 64,112,061 T497I probably benign Het
Pikfyve T C 1: 65,196,681 F171L probably damaging Het
Pilrb1 T G 5: 137,857,392 K79T probably benign Het
Pin1 C T 9: 20,655,364 R21W probably damaging Het
Ptprq A G 10: 107,686,392 probably benign Het
Rad17 G A 13: 100,622,863 A552V possibly damaging Het
Rbbp8 A G 18: 11,718,868 T249A probably benign Het
Rtkn A T 6: 83,135,976 I10F probably benign Het
Scube2 T A 7: 109,857,590 I103F possibly damaging Het
Sec23b A G 2: 144,581,973 H514R probably benign Het
Serbp1 T A 6: 67,272,220 D223E probably benign Het
Slc14a1 C A 18: 78,111,392 V260L probably benign Het
Slc22a23 A G 13: 34,183,126 I633T probably damaging Het
Stk19 A T 17: 34,824,747 probably benign Het
Svs2 T C 2: 164,237,127 M287V probably benign Het
Syne3 T A 12: 104,958,066 Q358L probably damaging Het
Synj1 A G 16: 91,010,096 F58L possibly damaging Het
Tg T C 15: 66,674,023 V198A probably damaging Het
Tle4 A T 19: 14,597,388 Y9N probably damaging Het
Tmem57 A G 4: 134,804,481 Y626H probably damaging Het
Tmx3 G A 18: 90,524,335 A186T possibly damaging Het
Trmt13 A G 3: 116,581,518 F447S probably damaging Het
Trp53bp1 T A 2: 121,228,626 H918L probably damaging Het
Ush2a T G 1: 188,728,504 V2654G probably benign Het
Vmn2r25 A G 6: 123,840,098 Y175H probably damaging Het
Zfp335 T C 2: 164,892,189 D1330G probably damaging Het
Other mutations in Traf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Traf3 APN 12 111239067 missense probably damaging 0.99
IGL02015:Traf3 APN 12 111252740 missense probably benign
IGL02318:Traf3 APN 12 111237597 missense probably benign
IGL02429:Traf3 APN 12 111243465 missense probably benign 0.19
IGL03088:Traf3 APN 12 111261843 missense probably damaging 0.99
bananasplit UTSW 12 111262036 missense probably damaging 1.00
Han UTSW 12 111261576 missense probably damaging 1.00
Hulk UTSW 12 111261576 missense probably damaging 1.00
sundae UTSW 12 111255224 missense possibly damaging 0.80
R0023:Traf3 UTSW 12 111243478 nonsense probably null
R0143:Traf3 UTSW 12 111261576 missense probably damaging 1.00
R1453:Traf3 UTSW 12 111255323 missense probably damaging 0.96
R1507:Traf3 UTSW 12 111260760 missense probably benign 0.30
R1651:Traf3 UTSW 12 111262036 missense probably damaging 1.00
R1714:Traf3 UTSW 12 111242473 missense probably benign 0.01
R1996:Traf3 UTSW 12 111260661 missense probably benign 0.21
R1997:Traf3 UTSW 12 111260661 missense probably benign 0.21
R4477:Traf3 UTSW 12 111248602 missense probably benign 0.00
R4645:Traf3 UTSW 12 111261966 missense probably damaging 1.00
R4723:Traf3 UTSW 12 111262036 missense probably damaging 1.00
R4820:Traf3 UTSW 12 111260770 missense possibly damaging 0.96
R5123:Traf3 UTSW 12 111243518 missense possibly damaging 0.52
R5775:Traf3 UTSW 12 111252728 missense possibly damaging 0.91
R5825:Traf3 UTSW 12 111255361 missense probably benign 0.03
R5912:Traf3 UTSW 12 111255349 missense probably benign 0.01
R6611:Traf3 UTSW 12 111237640 missense possibly damaging 0.76
R6933:Traf3 UTSW 12 111255224 missense possibly damaging 0.80
R7389:Traf3 UTSW 12 111237753 missense probably damaging 1.00
R7425:Traf3 UTSW 12 111260661 nonsense probably null
X0052:Traf3 UTSW 12 111252736 missense probably benign 0.41
Z1176:Traf3 UTSW 12 111261836 missense probably damaging 1.00
Z1177:Traf3 UTSW 12 111261492 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGAAATGGCTCACAGGGCTC -3'
(R):5'- TTCACCTGCTCCAGTGAGAG -3'

Sequencing Primer
(F):5'- GCTAGCTCTCCAGAATTCCC -3'
(R):5'- ATGCTGACCCAGGCTGTAC -3'
Posted On2015-04-17