Mutagenetix > Incidental Mutation

Incidental Mutation 'R3946:Rad17'

307728

Institutional Source

Beutler Lab

Gene Symbol

Rad17

Ensembl Gene

ENSMUSG00000021635

Gene Name

RAD17 checkpoint clamp loader component

Synonyms

MmRad24, 9430035O09Rik

MMRRC Submission

040827-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3946 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100617164-100651051 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 100622863 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 552 (A552V)

Ref Sequence

ENSEMBL: ENSMUSP00000136292 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022136] [ENSMUST00000177848] [ENSMUST00000226050]

AlphaFold

Q6NXW6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022136
AA Change: A552V

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000022136
Gene: ENSMUSG00000021635
AA Change: A552V

Domain	Start	End	E-Value	Type
low complexity region	30	39	N/A	INTRINSIC
AAA	128	280	1.1e-4	SMART
low complexity region	342	355	N/A	INTRINSIC
low complexity region	552	567	N/A	INTRINSIC
low complexity region	619	635	N/A	INTRINSIC
low complexity region	669	687	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177848
AA Change: A552V

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000136292
Gene: ENSMUSG00000021635
AA Change: A552V

Domain	Start	End	E-Value	Type
low complexity region	30	39	N/A	INTRINSIC
AAA	128	280	1.1e-4	SMART
low complexity region	342	355	N/A	INTRINSIC
low complexity region	552	567	N/A	INTRINSIC
low complexity region	619	635	N/A	INTRINSIC
low complexity region	669	687	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225428

Predicted Effect

probably benign
Transcript: ENSMUST00000226050

Meta Mutation Damage Score

0.4362

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.1%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the gene product of Schizosaccharomyces pombe rad17, a cell cycle checkpoint gene required for cell cycle arrest and DNA damage repair in response to DNA damage. This protein shares strong similarity with DNA replication factor C (RFC), and can form a complex with RFCs. This protein binds to chromatin prior to DNA damage and is phosphorylated by the checkpoint kinase ATR following damage. This protein recruits the RAD1-RAD9-HUS1 checkpoint protein complex onto chromatin after DNA damage, which may be required for its phosphorylation. The phosphorylation of this protein is required for the DNA-damage-induced cell cycle G2 arrest, and is thought to be a critical early event during checkpoint signaling in DNA-damaged cells. Multiple alternatively spliced transcript variants of this gene, which encode four distinct protein isoforms, have been reported. Two pseudogenes, located on chromosomes 7 and 13, have been identified. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality with incomplete somite formation, abnormal bracnchial arch, liver, and heart morphology, abnormal neural tube development, and multiple hemorrhages. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaed1	T	C	13: 64,309,098	I104V	probably damaging	Het
Abi2	A	G	1: 60,453,754	Q328R	probably damaging	Het
Agr3	C	A	12: 35,947,513		probably benign	Het
Brca2	T	A	5: 150,536,704	S481R	probably damaging	Het
Cabin1	T	G	10: 75,745,259	Q411P	probably damaging	Het
Calr3	A	G	8: 72,443,620	Y22H	probably damaging	Het
Caprin1	T	A	2: 103,796,766	I59F	probably damaging	Het
Cdk5rap1	T	C	2: 154,348,716	T442A	probably damaging	Het
Chn2	T	C	6: 54,269,426		probably benign	Het
Cic	C	A	7: 25,272,346	R501S	possibly damaging	Het
Coch	A	G	12: 51,601,812		probably null	Het
Defa25	G	A	8: 21,084,490	V17I	probably null	Het
Dglucy	T	C	12: 100,838,700		probably null	Het
Dtx1	T	G	5: 120,681,286	T616P	possibly damaging	Het
Eef1g	T	C	19: 8,969,977	L171P	probably benign	Het
Fam135a	A	G	1: 24,030,394	S465P	probably damaging	Het
Gm14025	A	G	2: 129,039,601	L135P	probably damaging	Het
Gm14412	A	T	2: 177,314,685	C472*	probably null	Het
Gm7104	T	C	12: 88,286,042		noncoding transcript	Het
Got2	A	G	8: 95,888,230	S26P	probably benign	Het
H2-M11	A	G	17: 36,549,231	I329M	probably damaging	Het
Hmcn2	T	A	2: 31,382,394	D1295E	possibly damaging	Het
Hoxd12	G	T	2: 74,675,427	R114L	probably damaging	Het
Ilkap	A	C	1: 91,387,250	D124E	probably damaging	Het
Med6	T	C	12: 81,581,851	Y88C	probably damaging	Het
Mep1a	A	T	17: 43,475,041	L719*	probably null	Het
Mmp23	T	C	4: 155,652,023	Y187C	probably damaging	Het
Myo1g	A	G	11: 6,520,760	M32T	possibly damaging	Het
Ncstn	T	C	1: 172,067,494	E614G	probably benign	Het
Nr2c2	C	T	6: 92,163,138	R464W	probably damaging	Het
Olfr1309	G	A	2: 111,983,297	T259M	possibly damaging	Het
Otub2	T	A	12: 103,392,826	L58*	probably null	Het
Pcdhga12	G	A	18: 37,767,629	V505I	probably benign	Het
Pcdhga9	T	A	18: 37,737,844	V242D	probably damaging	Het
Pex1	C	T	5: 3,626,084	L891F	probably damaging	Het
Pgm1	C	T	5: 64,112,061	T497I	probably benign	Het
Pikfyve	T	C	1: 65,196,681	F171L	probably damaging	Het
Pilrb1	T	G	5: 137,857,392	K79T	probably benign	Het
Pin1	C	T	9: 20,655,364	R21W	probably damaging	Het
Ptprq	A	G	10: 107,686,392		probably benign	Het
Rbbp8	A	G	18: 11,718,868	T249A	probably benign	Het
Rtkn	A	T	6: 83,135,976	I10F	probably benign	Het
Scube2	T	A	7: 109,857,590	I103F	possibly damaging	Het
Sec23b	A	G	2: 144,581,973	H514R	probably benign	Het
Serbp1	T	A	6: 67,272,220	D223E	probably benign	Het
Slc14a1	C	A	18: 78,111,392	V260L	probably benign	Het
Slc22a23	A	G	13: 34,183,126	I633T	probably damaging	Het
Stk19	A	T	17: 34,824,747		probably benign	Het
Svs2	T	C	2: 164,237,127	M287V	probably benign	Het
Syne3	T	A	12: 104,958,066	Q358L	probably damaging	Het
Synj1	A	G	16: 91,010,096	F58L	possibly damaging	Het
Tg	T	C	15: 66,674,023	V198A	probably damaging	Het
Tle4	A	T	19: 14,597,388	Y9N	probably damaging	Het
Tmem57	A	G	4: 134,804,481	Y626H	probably damaging	Het
Tmx3	G	A	18: 90,524,335	A186T	possibly damaging	Het
Traf3	G	A	12: 111,255,245	S280N	possibly damaging	Het
Trmt13	A	G	3: 116,581,518	F447S	probably damaging	Het
Trp53bp1	T	A	2: 121,228,626	H918L	probably damaging	Het
Ush2a	T	G	1: 188,728,504	V2654G	probably benign	Het
Vmn2r25	A	G	6: 123,840,098	Y175H	probably damaging	Het
Zfp335	T	C	2: 164,892,189	D1330G	probably damaging	Het

Other mutations in Rad17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Rad17	APN	13	100629525	missense	probably benign	0.03
IGL00422:Rad17	APN	13	100629523	missense	probably damaging	0.98
IGL00478:Rad17	APN	13	100633274	missense	probably damaging	1.00
IGL01328:Rad17	APN	13	100617803	missense	probably benign
IGL01720:Rad17	APN	13	100622858	missense	possibly damaging	0.51
IGL01874:Rad17	APN	13	100617684	utr 3 prime	probably benign
IGL02305:Rad17	APN	13	100633862	critical splice donor site	probably null
IGL02541:Rad17	APN	13	100633443	splice site	probably benign
R0678:Rad17	UTSW	13	100645184	missense	possibly damaging	0.73
R1079:Rad17	UTSW	13	100633899	missense	probably benign	0.01
R1422:Rad17	UTSW	13	100645082	missense	probably benign	0.18
R1730:Rad17	UTSW	13	100622806	missense	probably damaging	0.97
R4577:Rad17	UTSW	13	100633278	missense	probably damaging	1.00
R4735:Rad17	UTSW	13	100619129	missense	probably damaging	0.98
R5023:Rad17	UTSW	13	100645063	missense	possibly damaging	0.88
R5098:Rad17	UTSW	13	100617646	makesense	probably null
R5222:Rad17	UTSW	13	100633891	missense	possibly damaging	0.53
R5511:Rad17	UTSW	13	100627649	missense	possibly damaging	0.82
R5536:Rad17	UTSW	13	100631104	missense	probably damaging	1.00
R5887:Rad17	UTSW	13	100633861	critical splice donor site	probably null
R6041:Rad17	UTSW	13	100617766	missense	probably benign	0.01
R6173:Rad17	UTSW	13	100622881	missense	probably benign
R6342:Rad17	UTSW	13	100619136	missense	probably damaging	1.00
R6465:Rad17	UTSW	13	100637080	missense	probably benign	0.34
R6730:Rad17	UTSW	13	100649745	start gained	probably benign
R6890:Rad17	UTSW	13	100637084	missense	probably benign	0.34
R6947:Rad17	UTSW	13	100622875	missense	probably damaging	1.00
R7035:Rad17	UTSW	13	100627625	missense	possibly damaging	0.78
R7113:Rad17	UTSW	13	100629517	missense	probably benign	0.03
R7408:Rad17	UTSW	13	100629511	nonsense	probably null
R7553:Rad17	UTSW	13	100633286	missense	probably damaging	1.00
R7573:Rad17	UTSW	13	100629466	missense	probably damaging	0.99
R8313:Rad17	UTSW	13	100624566	missense	probably benign	0.02
R8346:Rad17	UTSW	13	100645173	missense	possibly damaging	0.77
R8739:Rad17	UTSW	13	100629490	missense	probably benign
R8874:Rad17	UTSW	13	100617819	missense	probably benign	0.00
R8921:Rad17	UTSW	13	100617684	utr 3 prime	probably benign
R8950:Rad17	UTSW	13	100631068	missense	probably damaging	1.00
R9189:Rad17	UTSW	13	100637056	missense	probably damaging	1.00
R9367:Rad17	UTSW	13	100633212	missense	possibly damaging	0.79
R9431:Rad17	UTSW	13	100643566	missense	probably damaging	1.00
R9447:Rad17	UTSW	13	100627611	missense	probably damaging	1.00
R9624:Rad17	UTSW	13	100636995	missense	probably damaging	0.99
RF022:Rad17	UTSW	13	100637085	missense	probably damaging	1.00
Z1176:Rad17	UTSW	13	100627632	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- AAATGACACTGGGTTGCCA -3'
(R):5'- GCCAGACCCAAAGTATTAATGAACT -3'

Sequencing Primer
(F):5'- TGGCTCAGCTGTTAAGAACG -3'
(R):5'- GTCCCAGAACTTGATGTGTAGACC -3'

Posted On

2015-04-17